Lin28 overexpression inhibits neurite outgrowth of primary cortical neurons in vitro

Publications

Share / Export Citation / Email / Print / Text size:

Acta Neurobiologiae Experimentalis

Nencki Institute of Experimental Biology

Subject: Behavioral Sciences, Biomedical Sciences & Nutrition, Life Sciences, Medicine, Neurosciences

GET ALERTS

ISSN: 0065-1400
eISSN: 1689-0035

DESCRIPTION

37
Reader(s)
85
Visit(s)
0
Comment(s)
0
Share(s)

SEARCH WITHIN CONTENT

FIND ARTICLE

Volume / Issue / page

Related articles

VOLUME 78 , ISSUE 4 (December 2018) > List of articles

Lin28 overexpression inhibits neurite outgrowth of primary cortical neurons in vitro

Mohammad Iqbal Hossain Bhuiyan / Seong Yun Kim / Kyung-Ok Cho *

Keywords : Lin28, in utero electroporation, primary cortical neuron, neurite outgrowth, HMGA2

Citation Information : Acta Neurobiologiae Experimentalis. Volume 78, Issue 4, Pages 297-304, DOI: https://doi.org/10.21307/ane-2018-028

License : (CC-BY-4.0)

Received Date : 29-June-2018 / Accepted: 03-October-2018 / Published Online: 15-January-2019

ARTICLE

ABSTRACT

Lin28 has been shown to promote proliferation of progenitors and survival of neurons during cortical neurogenesis. However, the role of Lin28 in the terminal maturation of neurons remains obscured. In this study, we investigated the developmental impact of Lin28 overexpression on neurite outgrowth. Lin28 expression was upregulated by in utero electroporation at E14.5. Two days later, electroporated cortices were dissociated for culturing primary cortical neurons. We found that Lin28 overexpression, which was confirmed immunocytochemically, led to neurite underdevelopment for all time points during culture. Specifically, Lin28-overexpressing cells displayed significantly fewer primary neurites and a decreased dendritic branching index, compared to GFP-expressing controls. Additionally, Lin28 overexpression in primary cortical neurons induced the expression of high mobility group AT-Hook 2 (HMGA2). Taken together, our study demonstrates that constitutive Lin28 expression disrupts cortical neurogenesis resulting in impaired neurite outgrowth with a concomitant induction of HMGA2.

Graphical ABSTRACT

INTRODUCTION

Lin28 is an RNA-binding protein containing a cold shock domain and two CCHC-type zinc fingers (Moss et al. 1997). It has two paralogs, Lin28A and Lin28B, which are known to block let-7 miRNA biogenesis (Piskounova et al. 2011). During mammalian development, Lin28 plays various roles in many biological processes including embryogenesis (Yokoyama et al. 2008), skeletal myogenesis (Polesskaya et al. 2007), germ cell development (West et al. 2009), and the regulation of body size and onset of puberty (Zhu et al. 2010). Additionally, the demonstration of Lin28’s involvement in glucose metabolism (Zhu et al. 2011), tissue repair (Shyh-Chang et al. 2013), and cancer progression (Ma et al. 2014) suggests that Lin28 is a pleiotropic molecule. Reports have shown that Lin28 is highly expressed in undifferentiated cells, such as stem cells, and downregulated as cellular differentiation proceeds (Xu et al. 2009, Yang and Moss 2003). In line with this, many studies have investigated the role of Lin28 in stem cell reprogramming and neurogenesis. For example, Lin28 is one of several stemness factors that can reprogram somatic cells to pluripotent stem cells (Hanna et al. 2009, Yu et al. 2007). Moreover, Lin28 promotes proliferation of stem cells and progenitors (Bhuiyan et al. 2013, Cimadamore et al. 2013, Xu et al. 2009, Yang et al. 2015). Regarding neurogenesis, Lin28 was shown to contribute to neuronal cell fate choices at the expense of gliogenesis (Balzer et al. 2010) and to enhance survival of cortical neurons (Bhuiyan et al. 2013). Additionally, inhibition of neural stem cell differentiation by Lin28 through regulation of the Sox2/Lin28/let-7 signaling pathway was reported (Morgado et al. 2016). However, the necessity of Lin28 for terminal maturation of neurons has not yet been established.

Therefore, in the present study, we investigated the impact of Lin28 overexpression on neurite arborization utilizing primary cortical neuronal culture following in utero electroporation. Since physiological neurite extension and the elongation of neurite arbors during development is critical for proper neuronal function, disruption of this process can significantly impact neurodevelopment (Gilbert and Man 2017). By analyzing the number of primary neurites and the branching index we found that Lin28 overexpression significantly impaired neurite outgrowth. In addition, we found that high mobility group AT-Hook 2 (HMGA2) was induced by Lin28 overexpression, which is one of the important Lin28 downstream molecules (Fujii et al. 2013, Morgado et al. 2016, Yang et al. 2015, Zhu et al. 2011). Our findings demonstrate a crucial role for Lin28 in neuronal maturation, which may be achieved through the upregulation of HMGA2 expression.

METHODS

Construction of plasmids

pCAGGS–GFP or pCAGGS–Lin28-GFP were generated as described previously (Bhuiyan et al. 2013). Briefly, Lin28 cDNA was amplified with a 5’ primer with an XbaI site (GCTCTAGAGATGGGCTCGGTGTCCAACCAGCA) and a 3’ primer containing an overlapping sequence of the GFP gene (CTCACCATATTCTGGGCTTCTGGGAGCAGG). In addition, GFP cDNA was separately amplified with a 5’ primer containing an overlapping sequence of Lin28 cDNA (CCCAGAATATGGTGAGCAAGGGCGAGGAGCT) and a 3’ primer with an EcoRI site (GTGAATTCTTACTTGTACAGCTCGTCCATGCCGAGAG). Using these two PCR products as templates, PCR was also performed with a 5’ primer for Lin28 with an XbaI site and a 3’ primer for GFP with an EcoRI site and cloned into a pCR 3.1 vector (Promega, Madison, WI, USA). After verifying the nucleotide sequence, the insert was cloned into the pCAGGS vector (Niwa et al. 1991) at XbaI and EcoRI sites (Lin28-GFP). GFP cDNA was also cloned into the pCAGGS vector at the EcoRI site as a control (GFP).

In utero electroporation

Pregnant C57BL/6N mice were purchased from Koatech (Gyeonggi-do, Korea) and were housed in the animal facility with food and water ad libitum. The day of vaginal plug detection was designated as embryonic day (E) 0.5. All animal experiments were performed according to the Ethics Committee of The Catholic University of Korea and were carried out in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH Publication No. 80–23, revised 1996). In utero electroporation was performed as described previously with minor modifications (Tabata and Nakajima 2001). Briefly, pregnant mice at E14.5 were anesthetized with 1% isoflurane balanced with 30% O2 and 70% N2O. After the uterine horns were exposed, 1 µl of DNA solution (1 µg/µl) containing 0.01% fast green solution was injected into the right lateral ventricle using a pulled glass micropipette. Then, electronic pulses (40 V, 50 ms, seven times) at 1 s intervals were applied using an electroporator (CUY21SC, NEPA Gene, Chiba, Japan) with tweezer-type electrodes. Then, embryos were placed back into the abdominal cavity and sutured. During the procedure, rectal temperature of the pregnant mouse was maintained at 36.5–37.5°C. The embryos were allowed to develop normally for 2 days.

Primary culture of cortical neurons

Two days following in utero electroporation, when the electroporated embryos were expressing detectable levels of GFP, brains of E16.5 mouse embryos were harvested for cortical neuronal cell culture. High density cultures of dissociated primary cortical neurons were prepared according to our previously established method with minor modifications (Bhuiyan et al. 2012). In brief, under a dissecting microscope, electroporated right cerebral cortices were collected in Ca2+and Mg2+-free Hank’s balanced salt solution (HBSS, Thermo Fisher Scientific Inc., Waltham, MA, USA) and incubated with 0.025% trypsin for 10 min at 37°C. Enzymatic digestion was terminated by mixing the suspension with DMEM supplemented with 10% FBS (Thermo Fisher Scientific Inc.). After gentle trituration, the cells were passed through cell strainers (Becton, Dickinson and Company, Franklin Lakes, NJ, USA) and collected by brief centrifugation. The dissociated cells were suspended in Neurobasal medium supplemented with 2% B27, 0.5 mM glutamine, 25 µM glutamate, 50 units/ml penicillin and 50 µg/ml streptomycin (Thermo Fisher Scientific Inc.). The cells were then plated on 10-cm and 24-well plates (pre-coated with 10 mg/ml poly-L-lysine) at a density of ≈1200 cells/mm2 and incubated at 37°C with 5% CO2. The seeding medium was replaced with maintenance medium (without glutamate) one day after plating and refreshed twice a week. The cells that survived in serum-free culture were mostly neurons (Brewer et al. 1993). These cultures were composed of approximately 99% neuronal cells as estimated by immunocytochemical staining with anti-neuron specific nuclear protein (NeuN) and anti-glial fibrillary acidic protein (GFAP) (Bhuiyan et al. 2011).

Immunocytochemistry

Primary cortical neurons grown on 12-mm glass coverslips were washed with Dulbecco’s phosphate-buffered saline (DPBS, pH 7.4) and fixed with 4% paraformaldehyde in 0.1 M phosphate buffer, pH 7.4 for 15 min. Then, the cells were permeabilized with 0.15% Triton X-100 for 15 min, followed by DPBS washing three times for 5 min. After blocking with 10% normal goat serum for 2 h at room temperature, the cells were incubated with rabbit anti-GFP (1:1000, Thermo Fisher Scientific Inc.) overnight at 4°C. After several rinses in DPBS, the cells were incubated with anti-rabbit Alexa Fluor 488 conjugated IgG (1:500, Thermo Fisher Scientific Inc.) for 2 h at room temperature. For double staining, goat anti-Lin28 (1:300; Santa Cruz Biotechnology Inc.), and rabbit anti-high mobility group AT-Hook 2 (1:300, HMGA2; Cell Signaling Technology, Danvers, MA, USA), anti-goat Alexa Fluor 647 conjugated IgG (1:500, Thermo Fisher Scientific Inc.), and anti-rabbit Cy3 conjugated IgG (1:500, Jackson ImmunoResearch Laboratories) were used. The primary and secondary antibodies were diluted in 3% normal goat serum. After a final DPBS wash three times for 5 min, glass coverslips were mounted onto slides with ProLongTM Gold fluorescent mounting media and visualized under a confocal microscope (LSM 510 Meta, Zeiss, Oberkochen, Germany).

Quantitative analysis of neurite outgrowth

Quantitative analysis of dendritic arborization was performed by assessing the number of primary neurites and their branching index (Perycz et al. 2011, Song et al. 2002). Briefly, each image of cultured cortical neurons acquired from a series of z-stack confocal images was flattened into a single image using maximum projection. Using ImageJ software (NIH), we defined a neurite or a branch as a protrusion >10 µm to exclude dendritic filopodia and spines. All neurites that extended directly from the cell body were counted as primary neurites. For dendritic branching index analysis, we counted total primary branch points along a 50 µm length of the most complex dendrite near the cell soma. The dendritic branching index was calculated as the total number of primary branch points per 10 µm length of a dendrite. A minimum of 15 cells were evaluated for each analysis.

Intensity measurement analysis

For assessing the expression of Lin28 and HMGA2 in cortical neurons, images of GFP-expressing cells were captured at 3 days in vitro (DIV). Using ImageJ software, Lin28 or HMGA2 expression in the cell body was analyzed by measuring the fluorescence intensity at each pixel in the image and averaged to show mean fluorescence intensity. A minimum of 25 cells per each group were analyzed.

Statistical analysis

Data were expressed as the mean ± standard errors of the mean (SEM). All statistical analyses were carried out using Prism 7 (GraphPad Software Inc., La Jolla, CA, USA). Statistical significance was assessed with the Mann-Whitney U test to compare GFP and Lin28-GFP groups as normal distribution was not assumed. p<0.05 was considered to be statistically significant.

RESULTS

Impaired neurite outgrowth by Lin28-GFP overexpression in primary cortical neurons

In order to investigate cortical neuronal development, we dissociated the electroporated cerebral hemisphere and cultured the neurons. When we examined temporal maturation of GFP-expressing cells, we found that GFP-electroporated cells started to sprout and extend neurites at DIV2 (Fig. 1A). Additional primary neurites sprouted, extended and branched out to form complex dendritic arbors in GFP-electroporated neurons through DIV13. In contrast, Lin28-GFP-overexpressing cells sprouted very few neurites at DIV2 and did not branch out primary neurites after DIV5 (Fig. 1B). These data indicate that Lin28 overexpression during cortical neurogenesis can inhibit neurite development.

Fig. 1.

Lin28-GFP overexpression impaired neurite outgrowth in primary cortical neurons. (A) Representative images of temporal neurite development in GFP-expressing cells. (B) Representative images of temporal neurite development in Lin28-GFP-expressing cells. At E16.5, right cortical tissues that were electroporated in utero with GFP or Lin28-GFP vectors at E14.5 were dissociated and cultured in neuron-favorable media. Scale bar=20 μm.

10.21307_ane-2018-028-f001.jpg

Quantitative analysis of neurite arborization in primary cortical neurons overexpressing Lin28-GFP

We performed further quantitative analysis of neurite morphogenesis by assessing the number of primary neurites (Fig. 2A) and their branching indexes by measuring a 50 µm length of the most complex neurite (Fig. 2C). The mean number of primary neurites in GFP-expressing neurons was 3.60±0.39 at DIV2 and 10.59±1.61 at DIV13 (Fig. 2B). On the other hand, protrusions of primary neurites in Lin28-GFP-overexpressing neurons were only observed at the early time point of DIV2 to DIV5 (2.75±0.24 to 4.18±0.37, respectively). After DIV5, there was no significant increase in the number of primary neurites with Lin28 overexpression (Fig. 2B). Compared to GFP-expressing neurons, the mean number of primary neurites in Lin28-GFP-overexpressing cells was significantly decreased at all time points examined (Mann-Whitney U test; DIV2, U=1012.50, p=0.011; DIV5, U=813.50, p<0.001; DIV9, U=300.00, p<0.001; DIV13, U=212.50, p<0.001). Moreover, the dendritic branching index (Fig. 2C, D), an indicator of complex dendritic arborization, was markedly reduced in Lin28-GFP-overexpressing neurons compared to GFP-expressing controls from DIV5 to DIV13 (Mann-Whitney U test; DIV2, U=129.00, p=0.087; DIV5, U=75.00, p<0.001; DIV9, U=38.00, p<0.001; DIV13, U=16.00, p<0.001). Together, these data demonstrate that the overexpression of Lin28-GFP in primary cortical neurons resulted in fewer primary neurites and simpler dendritic trees.

Fig. 2.

Lin28-GFP overexpression significantly decreased neurite sprouting and dendritic branching. (A) A representative image of how primary neurites were analyzed. The number of primary neurites that were at least 10 µm long was counted. Scale bar=10 μm. (B) A graph showing the number of primary neurites. Note that Lin28-GFP-expressing cells had fewer primary neurites than GFP-expressing controls at each time point examined. * p<0.05 by Mann-Whitney U test between GFPand Lin28-GFP-electroporated cells. Sample size for GFP group was 46 (DIV2), 32 (DIV5), 33 (DIV9), 32 (DIV13), and for Lin28-GFP groups was 61 (DIV2), 106 (DIV5), 80 (DIV9), and 97 (DIV13). Data represent mean ± S.E.M. (C) A representative image of how to calculate dendritic branching index. The number of branching points of an apical dendrite for a 50 µm length was counted and the value was presented as dendritic branching number per 10 µm. Scale bar=20 μm. (D) A graph showing dendritic branching index. Lin28-GFP-expressing cells showed decreased values for branching index, compared to controls. * p<0.05 by Mann-Whitney U test between GFPand Lin28-GFP-electroporated cells. Sample size for GFP group was 21 (DIV2), 17 (DIV5), 18 (DIV9), 19 (DIV13), and for Lin28-GFP groups was 18 (DIV2), 25 (DIV5), 24 (DIV9), and 21 (DIV13). Data represent mean ± S.E.M.

10.21307_ane-2018-028-f002.jpg

Increased expression of HMGA2 by Lin28-GFP overexpression

To gain insight into the molecular mechanisms of neurite underdevelopment found with Lin28-GFP overexpression, we performed immunocytochemistry. At DIV3, GFP-electroporated cells showed a signal for GFP but no signals for Lin28 or HMGA2, while Lin28-GFP-electroporated cells showed immunoreactivity for both Lin28 and HMGA2 (Fig. 3A). Fluorescence intensity was then assayed for HMGA2 and Lin28 expression for quantitative analysis (Fig. 3B, C). Both HMGA2 and Lin28 expression were significantly increased by Lin28-GFP overexpression (Mann-Whitney U test; U=0.00, p<0.001 for HMGA2, U=0.00, p<0.001 for Lin28). Taken together, these data demonstrated successful Lin28 overexpression and indicate a possible molecular mechanism induced by constitutive Lin28 expression during cortical neurogenesis.

Fig. 3.

Lin28-GFP overexpression induced high mobility group AT-Hook 2 (HMGA2) expression. (A) Representative fluorescent images showing GFP (green), Lin28 (blue), and HMGA2 (red) expression in electroporated cells. Scale bar=20 μm. (B) A graph showing mean fluorescence intensity of HMGA2 immunoreactivity. Note that HMGA2 expression was significantly increased in Lin28-GFP-overexpressing cells. * p<0.05 by Mann-Whitney U test between GFPand Lin28-GFP-electroporated cells. Sample size for each group is 25. Data represent mean ± S.E.M. (C) A graph showing mean fluorescence intensity of Lin28 immunoreactivity. Note that Lin28 expression was significantly increased in Lin28-GFP-overexpressing cells, whereas no signal was detected in GFP-expressing controls. * p<0.05 by Mann-Whitney U test between GFPand Lin28-GFP-electroporated cells. Sample size for each group is 25. Data represent mean ± S.E.M.

10.21307_ane-2018-028-f003.jpg

DISCUSSION

In the present study, we demonstrated that constitutive Lin28 expression led to neurite underdevelopment in primary cortical neurons in vitro. Specifically, Lin28-overexpressing cells showed a reduction in the number of primary neurites and the dendritic branching index. Lin28 overexpression was further confirmed by immunocytochemistry. The immunocytochemical analysis also demonstrated that Lin28 overexpression induced HMGA2 expression.

Neurite outgrowth in developing neurons is a fundamental feature for neural network formation. Using an established primary cortical neuronal culture method (Bhuiyan et al. 2013), we were able to faithfully track individual neuronal development including neurite morphogenesis. We found that constitutive Lin28 expression during cortical neurogenesis resulted in the inhibition of neurite maturation, suggesting that Lin28 may be a novel regulator of neurite outgrowth. Specifically, Lin28 overexpression hindered both neurite extension and dynamic elongation of dendritic arbors, as assessed by the number of primary neurites and dendritic branching index, respectively. Despite a variety of molecules, such as cytoskeleton constituents, growth factors and adhesion molecules, having been identified as modulating neurite outgrowth (Chiu and Cline 2010, Gordon-Weeks 2004, Kiryushko et al. 2004, Mattila and Lappalainen 2008), to our knowledge, our report is the first to demonstrate that mammalian Lin28 can play a direct role in neurite development. Interestingly in support of our findings, overexpression of Lin28 in C. elegans hermaphrodite-specific motor neurons inhibited axon extension during development, while loss-of-function mutations of Lin28 promoted precocious axon outgrowth (Olsson-Carter and Slack 2010). Moreover, though indirect evidence, downregulation of miR-145 resulted in a reduction in the number of neurites by increasing Lin28 expression (Morgado et al. 2016). Given that neurite development is a complex process controlled by diverse molecular players, it will be interesting to investigate how Lin28 interacts with established regulators of neurite outgrowth.

In order to elucidate molecular mechanisms of Lin28-derived neurite underdevelopment, we performed immunocytochemistry targeting a molecule, HMGA2, which is downstream of Lin28 (Fujii et al. 2013, Morgado et al. 2016, Yang et al. 2015, Zhu et al. 2011). We found that HMGA2 expression was induced by Lin28 overexpression. HMGA2 is a nonhistone chromatin-associated protein containing three AT hooks (Zhou et al. 1996). HMGA2 is predominantly expressed in the ventricular zone of the telencephalon and is downregulated as development proceeds (Hirning-Folz et al. 1998, Nishino et al. 2008). Although the major function of HMGA2 in the central nervous system is reported to be promoting proliferation of neural stem cells and progenitors (Nishino et al. 2008, Vukicevic et al. 2010, Yang et al. 2015), several reports have demonstrated the neurogenic potential of HMGA2, suggesting HMGA2 may be involved in cellular differentiation (Kishi et al. 2012, Sanosaka et al. 2008). Moreover, HMGA2 overexpression increased insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) in neural progenitors, increasing neurogenic potential (Fujii et al. 2013). It is additionally noteworthy that HMGA2 can be negatively modulated by let-7 miRNAs, one of the well-known targets of Lin28 (Lee and Dutta 2007, Nishino et al. 2008). Considering that let-7 miRNAs are required for neurite maturation due to their blocking of Lin28 (Morgado et al. 2016, Petri et al. 2017), it is plausible that a Lin28/let-7/HMGA2 axis may critically function in neurite outgrowth, as our results have suggested. Further studies are required to understand the detailed molecular mechanisms involved in Lin28-associated terminal maturation of cortical neurons.

CONCLUSION

Lin28 has garnered increasing scientific interest since it was reported to be one of the pluripotency factors (Yu et al. 2007). However, besides reprogramming potential, extensive research has demonstrated its central role in diverse biological processes such as regulation of development, proliferation, differentiation, glucose metabolism, tissue repair and tumorigenesis (Bhuiyan et al. 2013, Olsson-Carter and Slack 2010, Polesskaya et al. 2007, Thornton and Gregory 2012, Shinoda et al. 2013, Shyh-Chang et al. 2013, Yang et al. 2015, Zhu et al. 2011). In this study, we provided evidence for a novel function of Lin28, showing that constitutive Lin28 expression during cortical neurogenesis can inhibit neurite extension and complexity of dendritic arbors, possibly through upregulation of HMGA2. Impaired neurite development can result in maldevelopment of brain connectivity, as is frequently observed in neurodevelopmental disorders (Geschwind and Levitt 2007), thus understanding all of the molecules that may play a role in regulating the balance of neurite development is critical. Our findings demonstrate effects of disrupted neurite development during cortical neurogenesis and highlight the potential involvement of Lin28 in this process.

ACKNOWLEDGEMENTS

We thank Mr. Hyoun Geun Kim for his technical support. This work was supported by National Research Foundation of Korea (NRF) grants funded by the Korean government (NRF-2017R1D1A1B03029812) and the Korea Health Technology R&D Project through the Korea Health Industry Development Institute (KHIDI) funded by the Ministry of Health and Welfare (HI15C2854).

References


  1. Balzer E, Heine C, Jiang Q, Lee VM, Moss EG (2010) LIN28 alters cell fate succession and acts independently of the let-7 microRNA during neurogliogenesis in vitro. Development 137: 891–900.
    [CROSSREF]
  2. Bhuiyan MI, Kim HB, Kim SY, Cho KO (2011) The neuroprotective potential of cyanidin-3-glucoside fraction extracted from mulberry following oxygen-glucose deprivation. Korean J Physiol Pharmacol 15: 353–361.
    [CROSSREF]
  3. Bhuiyan MI, Kim JY, Ha TJ, Kim SY, Cho KO (2012) Anthocyanins extracted from black soybean seed coat protect primary cortical neurons against in vitro ischemia. Biol Pharm Bull 35: 999–1008.
    [CROSSREF]
  4. Bhuiyan MI, Lee JH, Kim SY, Cho KO (2013) Expression of exogenous LIN28 contributes to proliferation and survival of mouse primary cortical neurons in vitro. Neuroscience 248: 448–458.
    [CROSSREF]
  5. Brewer GJ, Torricelli JR, Evege EK, Price PJ (1993) Optimized survival of hippocampal neurons in B27-supplemented Neurobasal, a new serum-free medium combination. J Neurosci Res 35: 567–576.
    [CROSSREF]
  6. Chiu SL, Cline HT (2010) Insulin receptor signaling in the development of neuronal structure and function. Neural Dev 5: 7.
    [CROSSREF]
  7. Cimadamore F, Amador-Arjona A, Chen C, Huang CT, Terskikh AV (2013) SOX2-LIN28/let-7 pathway regulates proliferation and neurogenesis in neural precursors. Proc Natl Acad Sci 110: E3017-E3026.
    [CROSSREF]
  8. Fujii Y, Kishi Y, Gotoh Y (2013) IMP2 regulates differentiation potentials of mouse neocortical neural precursor cells. Genes Cells 18: 79–89.
    [CROSSREF]
  9. Geschwind DH, Levitt P (2007) Autism spectrum disorders: developmental disconnection syndromes. Curr Opin Neurobiol 17: 103–111.
    [CROSSREF]
  10. Gilbert J, Man HY (2017) Fundamental elements in autism: from neurogenesis and neurite growth to synaptic plasticity. Front Cell Neurosci 11: 359.
    [CROSSREF]
  11. Gordon-Weeks PR (2004) Microtubules and growth cone function. J Neurobiol 58: 70–83.
    [CROSSREF]
  12. Hanna J, Saha K, Pando B, van Zon J, Lengner CJ, Creyghton MP, van Oudenaarden A, Jaenisch R (2009) Direct cell reprogramming is a stochastic process amenable to acceleration. Nature 462: 595–601.
    [CROSSREF]
  13. Hirning-Folz U, Wilda M, Rippe V, Bullerdiek J, Hameister H (1998) The expression pattern of the Hmgic gene during development. Genes Chromosomes Cancer 23: 350–357.
    [CROSSREF]
  14. Kiryushko D, Berezin V, Bock E (2004) Regulators of neurite outgrowth: role of cell adhesion molecules. Ann N Y Acad Sci 1014: 140–154.
    [CROSSREF]
  15. Kishi Y, Fujii Y, Hirabayashi Y, Gotoh Y (2012) HMGA regulates the global chromatin state and neurogenic potential in neocortical precursor cells. Nat Neurosci 15: 1127–1133.
    [CROSSREF]
  16. Lee YS, Dutta A (2007) The tumor suppressor microRNA let-7 represses the HMGA2 oncogene. Genes Dev 21: 1025–1030.
    [CROSSREF]
  17. Ma XY, Li CC, Sun LC, Huang D, Li TT, He XP, Wu GW, Yang Z, Zhong XY, Song LB, Gao P, Zhang HF (2014) Lin28/let-7 axis regulates aerobic glycolysis and cancer progression via PDK1. Nat Commun 5: 5212.
    [CROSSREF]
  18. Mattila PK, Lappalainen P (2008) Filopodia: molecular architecture and cellular functions. Nat Rev Mol Cell Biol 9: 446–454.
    [CROSSREF]
  19. Morgado AL, Rodrigues CM, Sola S (2016) MicroRNA-145 regulates neural stem cell differentiation through the Sox2-Lin28/let-7 signaling pathway. Stem Cells 34: 1386–1395.
    [CROSSREF]
  20. Moss EG, Lee RC, Ambros V (1997) The cold shock domain protein LIN-28 controls developmental timing in C. elegans and is regulated by the lin-4 RNA. Cell 88: 637–646.
    [CROSSREF]
  21. Nishino J, Kim I, Chada K, Morrison SJ (2008) Hmga2 promotes neural stem cell self-renewal in young but not old mice by reducing p16Ink4a and p19Arf expression. Cell 135: 227–239.
    [CROSSREF]
  22. Niwa H, Yamamura K, Miyazaki J (1991) Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108: 193–199.
    [CROSSREF]
  23. Olsson-Carter K, Slack FJ (2010) A developmental timing switch promotes axon outgrowth independent of known guidance receptors. PLoS Genet 6: e1001054.
    [CROSSREF]
  24. Perycz M, Urbanska AS, Krawczyk PS, Parobczak K, Jaworski J (2011) Zipcode binding protein 1 regulates the development of dendritic arbors in hippocampal neurons. J Neurosci 31: 5271–5285.
    [CROSSREF]
  25. Petri R, Pircs K, Jonsson ME, Akerblom M, Brattas PL, Klussendorf T, Jakobsson J (2017) let-7 regulates radial migration of new-born neurons through positive regulation of autophagy. EMBO J 36: 1379–1391.
    [CROSSREF]
  26. Piskounova E, Polytarchou C, Thornton JE, LaPierre RJ, Pothoulakis C, Hagan JP, Iliopoulos D, Gregory RI (2011) Lin28A and Lin28B inhibit let-7 microRNA biogenesis by distinct mechanisms. Cell 147: 1066–1079.
    [CROSSREF]
  27. Polesskaya A, Cuvellier S, Naguibneva I, Duquet A, Moss EG, Harel-Bellan A (2007) Lin-28 binds IGF-2 mRNA and participates in skeletal myogenesis by increasing translation efficiency. Genes Dev 21: 1125–1138.
    [CROSSREF]
  28. Sanosaka T, Namihira M, Asano H, Kohyama J, Aisaki K, Igarashi K, Kanno J, Nakashima K (2008) Identification of genes that restrict astrocyte differentiation of midgestational neural precursor cells. Neuroscience 155: 780–788.
    [CROSSREF]
  29. Shinoda G, Shyh-Chang N, Soysa TY, Zhu H, Seligson MT, Shah SP, Abo-Sido N, Yabuuchi A, Hagan JP, Gregory RI, Asara JM, Cantley LC, Moss EG, Daley GQ (2013) Fetal deficiency of lin28 programs life-long aberrations in growth and glucose metabolism. Stem Cells 31: 1563–1573.
    [CROSSREF]
  30. Shyh-Chang N, Zhu H, Yvanka de Soysa T, Shinoda G, Seligson MT, Tsanov KM, Nguyen L, Asara JM, Cantley LC, Daley GQ (2013) Lin28 enhances tissue repair by reprogramming cellular metabolism. Cell 155: 778–792.
    [CROSSREF]
  31. Song HJ, Stevens CF, Gage FH (2002) Neural stem cells from adult hippocampus develop essential properties of functional CNS neurons. Nat Neurosci 5: 438–445.
    [CROSSREF]
  32. Tabata H, Nakajima K (2001) Efficient in utero gene transfer system to the developing mouse brain using electroporation: visualization of neuronal migration in the developing cortex. Neuroscience 103: 865–872.
    [CROSSREF]
  33. Thornton JE, Gregory RI (2012) How does Lin28 let-7 control development and disease? Trends Cell Biol 22: 474–482.
    [CROSSREF]
  34. Vukicevic V, Jauch A, Dinger TC, Gebauer L, Hornich V, Bornstein SR, Ehrhart-Bornstein M, Muller AM (2010) Genetic instability and diminished differentiation capacity in long-term cultured mouse neurosphere cells. Mech Ageing Dev 131: 124–132.
    [CROSSREF]
  35. West JA, Viswanathan SR, Yabuuchi A, Cunniff K, Takeuchi A, Park IH, Sero JE, Zhu H, Perez-Atayde A, Frazier AL, Surani MA, Daley GQ (2009) A role for Lin28 in primordial germ-cell development and germ-cell malignancy. Nature 460: 909–913.
    [CROSSREF]
  36. Xu B, Zhang K, Huang Y (2009) Lin28 modulates cell growth and associates with a subset of cell cycle regulator mRNAs in mouse embryonic stem cells. RNA 15: 357–361.
    [CROSSREF]
  37. Yang DH, Moss EG (2003) Temporally regulated expression of Lin-28 in diverse tissues of the developing mouse. Gene Expr Patterns 3: 719–726.
    [CROSSREF]
  38. Yang M, Yang SL, Herrlinger S, Liang C, Dzieciatkowska M, Hansen KC, Desai R, Nagy A, Niswander L, Moss EG, Chen JF (2015) Lin28 promotes the proliferative capacity of neural progenitor cells in brain development. Development 142: 1616–1627.
    [CROSSREF]
  39. Yokoyama S, Hashimoto M, Shimizu H, Ueno-Kudoh H, Uchibe K, Kimura I, Asahara H (2008) Dynamic gene expression of Lin-28 during embryonic development in mouse and chicken. Gene Expr Patterns 8: 155–160.
    [CROSSREF]
  40. Yu J, Vodyanik MA, Smuga-Otto K, Antosiewicz-Bourget J, Frane JL, Tian S, Nie J, Jonsdottir GA, Ruotti V, Stewart R, Slukvin II, Thomson JA (2007) Induced pluripotent stem cell lines derived from human somatic cells. Science 318: 1917–1920.
    [CROSSREF]
  41. Zhou X, Benson KF, Przybysz K, Liu J, Hou Y, Cherath L, Chada K (1996) Genomic structure and expression of the murine Hmgi-c gene. Nucleic Acids Res 24: 4071–4077.
    [CROSSREF]
  42. Zhu H, Shah S, Shyh-Chang N, Shinoda G, Einhorn WS, Viswanathan SR, Takeuchi A, Grasemann C, Rinn JL, Lopez MF, Hirschhorn JN, Palmert MR, Daley GQ (2010) Lin28a transgenic mice manifest size and puberty phenotypes identified in human genetic association studies. Nat Genet 42: 626–630.
    [CROSSREF]
  43. Zhu H, Shyh-Chang N, Segre AV, Shinoda G, Shah SP, Einhorn WS, Takeuchi A, Engreitz JM, Hagan JP, Kharas MG, Urbach A, Thornton JE, Triboulet R, Gregory RI, DIAGRAM Consortium, MAGIC Investigators, Altshuler D, Daley GQ (2011) The Lin28/let-7 axis regulates glucose metabolism. Cell 147: 81–94.
    [CROSSREF]
XML PDF Share

FIGURES & TABLES

Fig. 1.

Lin28-GFP overexpression impaired neurite outgrowth in primary cortical neurons. (A) Representative images of temporal neurite development in GFP-expressing cells. (B) Representative images of temporal neurite development in Lin28-GFP-expressing cells. At E16.5, right cortical tissues that were electroporated in utero with GFP or Lin28-GFP vectors at E14.5 were dissociated and cultured in neuron-favorable media. Scale bar=20 μm.

Full Size   |   Slide (.pptx)

Fig. 2.

Lin28-GFP overexpression significantly decreased neurite sprouting and dendritic branching. (A) A representative image of how primary neurites were analyzed. The number of primary neurites that were at least 10 µm long was counted. Scale bar=10 μm. (B) A graph showing the number of primary neurites. Note that Lin28-GFP-expressing cells had fewer primary neurites than GFP-expressing controls at each time point examined. * p<0.05 by Mann-Whitney U test between GFPand Lin28-GFP-electroporated cells. Sample size for GFP group was 46 (DIV2), 32 (DIV5), 33 (DIV9), 32 (DIV13), and for Lin28-GFP groups was 61 (DIV2), 106 (DIV5), 80 (DIV9), and 97 (DIV13). Data represent mean ± S.E.M. (C) A representative image of how to calculate dendritic branching index. The number of branching points of an apical dendrite for a 50 µm length was counted and the value was presented as dendritic branching number per 10 µm. Scale bar=20 μm. (D) A graph showing dendritic branching index. Lin28-GFP-expressing cells showed decreased values for branching index, compared to controls. * p<0.05 by Mann-Whitney U test between GFPand Lin28-GFP-electroporated cells. Sample size for GFP group was 21 (DIV2), 17 (DIV5), 18 (DIV9), 19 (DIV13), and for Lin28-GFP groups was 18 (DIV2), 25 (DIV5), 24 (DIV9), and 21 (DIV13). Data represent mean ± S.E.M.

Full Size   |   Slide (.pptx)

Fig. 3.

Lin28-GFP overexpression induced high mobility group AT-Hook 2 (HMGA2) expression. (A) Representative fluorescent images showing GFP (green), Lin28 (blue), and HMGA2 (red) expression in electroporated cells. Scale bar=20 μm. (B) A graph showing mean fluorescence intensity of HMGA2 immunoreactivity. Note that HMGA2 expression was significantly increased in Lin28-GFP-overexpressing cells. * p<0.05 by Mann-Whitney U test between GFPand Lin28-GFP-electroporated cells. Sample size for each group is 25. Data represent mean ± S.E.M. (C) A graph showing mean fluorescence intensity of Lin28 immunoreactivity. Note that Lin28 expression was significantly increased in Lin28-GFP-overexpressing cells, whereas no signal was detected in GFP-expressing controls. * p<0.05 by Mann-Whitney U test between GFPand Lin28-GFP-electroporated cells. Sample size for each group is 25. Data represent mean ± S.E.M.

Full Size   |   Slide (.pptx)

REFERENCES

  1. Balzer E, Heine C, Jiang Q, Lee VM, Moss EG (2010) LIN28 alters cell fate succession and acts independently of the let-7 microRNA during neurogliogenesis in vitro. Development 137: 891–900.
    [CROSSREF]
  2. Bhuiyan MI, Kim HB, Kim SY, Cho KO (2011) The neuroprotective potential of cyanidin-3-glucoside fraction extracted from mulberry following oxygen-glucose deprivation. Korean J Physiol Pharmacol 15: 353–361.
    [CROSSREF]
  3. Bhuiyan MI, Kim JY, Ha TJ, Kim SY, Cho KO (2012) Anthocyanins extracted from black soybean seed coat protect primary cortical neurons against in vitro ischemia. Biol Pharm Bull 35: 999–1008.
    [CROSSREF]
  4. Bhuiyan MI, Lee JH, Kim SY, Cho KO (2013) Expression of exogenous LIN28 contributes to proliferation and survival of mouse primary cortical neurons in vitro. Neuroscience 248: 448–458.
    [CROSSREF]
  5. Brewer GJ, Torricelli JR, Evege EK, Price PJ (1993) Optimized survival of hippocampal neurons in B27-supplemented Neurobasal, a new serum-free medium combination. J Neurosci Res 35: 567–576.
    [CROSSREF]
  6. Chiu SL, Cline HT (2010) Insulin receptor signaling in the development of neuronal structure and function. Neural Dev 5: 7.
    [CROSSREF]
  7. Cimadamore F, Amador-Arjona A, Chen C, Huang CT, Terskikh AV (2013) SOX2-LIN28/let-7 pathway regulates proliferation and neurogenesis in neural precursors. Proc Natl Acad Sci 110: E3017-E3026.
    [CROSSREF]
  8. Fujii Y, Kishi Y, Gotoh Y (2013) IMP2 regulates differentiation potentials of mouse neocortical neural precursor cells. Genes Cells 18: 79–89.
    [CROSSREF]
  9. Geschwind DH, Levitt P (2007) Autism spectrum disorders: developmental disconnection syndromes. Curr Opin Neurobiol 17: 103–111.
    [CROSSREF]
  10. Gilbert J, Man HY (2017) Fundamental elements in autism: from neurogenesis and neurite growth to synaptic plasticity. Front Cell Neurosci 11: 359.
    [CROSSREF]
  11. Gordon-Weeks PR (2004) Microtubules and growth cone function. J Neurobiol 58: 70–83.
    [CROSSREF]
  12. Hanna J, Saha K, Pando B, van Zon J, Lengner CJ, Creyghton MP, van Oudenaarden A, Jaenisch R (2009) Direct cell reprogramming is a stochastic process amenable to acceleration. Nature 462: 595–601.
    [CROSSREF]
  13. Hirning-Folz U, Wilda M, Rippe V, Bullerdiek J, Hameister H (1998) The expression pattern of the Hmgic gene during development. Genes Chromosomes Cancer 23: 350–357.
    [CROSSREF]
  14. Kiryushko D, Berezin V, Bock E (2004) Regulators of neurite outgrowth: role of cell adhesion molecules. Ann N Y Acad Sci 1014: 140–154.
    [CROSSREF]
  15. Kishi Y, Fujii Y, Hirabayashi Y, Gotoh Y (2012) HMGA regulates the global chromatin state and neurogenic potential in neocortical precursor cells. Nat Neurosci 15: 1127–1133.
    [CROSSREF]
  16. Lee YS, Dutta A (2007) The tumor suppressor microRNA let-7 represses the HMGA2 oncogene. Genes Dev 21: 1025–1030.
    [CROSSREF]
  17. Ma XY, Li CC, Sun LC, Huang D, Li TT, He XP, Wu GW, Yang Z, Zhong XY, Song LB, Gao P, Zhang HF (2014) Lin28/let-7 axis regulates aerobic glycolysis and cancer progression via PDK1. Nat Commun 5: 5212.
    [CROSSREF]
  18. Mattila PK, Lappalainen P (2008) Filopodia: molecular architecture and cellular functions. Nat Rev Mol Cell Biol 9: 446–454.
    [CROSSREF]
  19. Morgado AL, Rodrigues CM, Sola S (2016) MicroRNA-145 regulates neural stem cell differentiation through the Sox2-Lin28/let-7 signaling pathway. Stem Cells 34: 1386–1395.
    [CROSSREF]
  20. Moss EG, Lee RC, Ambros V (1997) The cold shock domain protein LIN-28 controls developmental timing in C. elegans and is regulated by the lin-4 RNA. Cell 88: 637–646.
    [CROSSREF]
  21. Nishino J, Kim I, Chada K, Morrison SJ (2008) Hmga2 promotes neural stem cell self-renewal in young but not old mice by reducing p16Ink4a and p19Arf expression. Cell 135: 227–239.
    [CROSSREF]
  22. Niwa H, Yamamura K, Miyazaki J (1991) Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108: 193–199.
    [CROSSREF]
  23. Olsson-Carter K, Slack FJ (2010) A developmental timing switch promotes axon outgrowth independent of known guidance receptors. PLoS Genet 6: e1001054.
    [CROSSREF]
  24. Perycz M, Urbanska AS, Krawczyk PS, Parobczak K, Jaworski J (2011) Zipcode binding protein 1 regulates the development of dendritic arbors in hippocampal neurons. J Neurosci 31: 5271–5285.
    [CROSSREF]
  25. Petri R, Pircs K, Jonsson ME, Akerblom M, Brattas PL, Klussendorf T, Jakobsson J (2017) let-7 regulates radial migration of new-born neurons through positive regulation of autophagy. EMBO J 36: 1379–1391.
    [CROSSREF]
  26. Piskounova E, Polytarchou C, Thornton JE, LaPierre RJ, Pothoulakis C, Hagan JP, Iliopoulos D, Gregory RI (2011) Lin28A and Lin28B inhibit let-7 microRNA biogenesis by distinct mechanisms. Cell 147: 1066–1079.
    [CROSSREF]
  27. Polesskaya A, Cuvellier S, Naguibneva I, Duquet A, Moss EG, Harel-Bellan A (2007) Lin-28 binds IGF-2 mRNA and participates in skeletal myogenesis by increasing translation efficiency. Genes Dev 21: 1125–1138.
    [CROSSREF]
  28. Sanosaka T, Namihira M, Asano H, Kohyama J, Aisaki K, Igarashi K, Kanno J, Nakashima K (2008) Identification of genes that restrict astrocyte differentiation of midgestational neural precursor cells. Neuroscience 155: 780–788.
    [CROSSREF]
  29. Shinoda G, Shyh-Chang N, Soysa TY, Zhu H, Seligson MT, Shah SP, Abo-Sido N, Yabuuchi A, Hagan JP, Gregory RI, Asara JM, Cantley LC, Moss EG, Daley GQ (2013) Fetal deficiency of lin28 programs life-long aberrations in growth and glucose metabolism. Stem Cells 31: 1563–1573.
    [CROSSREF]
  30. Shyh-Chang N, Zhu H, Yvanka de Soysa T, Shinoda G, Seligson MT, Tsanov KM, Nguyen L, Asara JM, Cantley LC, Daley GQ (2013) Lin28 enhances tissue repair by reprogramming cellular metabolism. Cell 155: 778–792.
    [CROSSREF]
  31. Song HJ, Stevens CF, Gage FH (2002) Neural stem cells from adult hippocampus develop essential properties of functional CNS neurons. Nat Neurosci 5: 438–445.
    [CROSSREF]
  32. Tabata H, Nakajima K (2001) Efficient in utero gene transfer system to the developing mouse brain using electroporation: visualization of neuronal migration in the developing cortex. Neuroscience 103: 865–872.
    [CROSSREF]
  33. Thornton JE, Gregory RI (2012) How does Lin28 let-7 control development and disease? Trends Cell Biol 22: 474–482.
    [CROSSREF]
  34. Vukicevic V, Jauch A, Dinger TC, Gebauer L, Hornich V, Bornstein SR, Ehrhart-Bornstein M, Muller AM (2010) Genetic instability and diminished differentiation capacity in long-term cultured mouse neurosphere cells. Mech Ageing Dev 131: 124–132.
    [CROSSREF]
  35. West JA, Viswanathan SR, Yabuuchi A, Cunniff K, Takeuchi A, Park IH, Sero JE, Zhu H, Perez-Atayde A, Frazier AL, Surani MA, Daley GQ (2009) A role for Lin28 in primordial germ-cell development and germ-cell malignancy. Nature 460: 909–913.
    [CROSSREF]
  36. Xu B, Zhang K, Huang Y (2009) Lin28 modulates cell growth and associates with a subset of cell cycle regulator mRNAs in mouse embryonic stem cells. RNA 15: 357–361.
    [CROSSREF]
  37. Yang DH, Moss EG (2003) Temporally regulated expression of Lin-28 in diverse tissues of the developing mouse. Gene Expr Patterns 3: 719–726.
    [CROSSREF]
  38. Yang M, Yang SL, Herrlinger S, Liang C, Dzieciatkowska M, Hansen KC, Desai R, Nagy A, Niswander L, Moss EG, Chen JF (2015) Lin28 promotes the proliferative capacity of neural progenitor cells in brain development. Development 142: 1616–1627.
    [CROSSREF]
  39. Yokoyama S, Hashimoto M, Shimizu H, Ueno-Kudoh H, Uchibe K, Kimura I, Asahara H (2008) Dynamic gene expression of Lin-28 during embryonic development in mouse and chicken. Gene Expr Patterns 8: 155–160.
    [CROSSREF]
  40. Yu J, Vodyanik MA, Smuga-Otto K, Antosiewicz-Bourget J, Frane JL, Tian S, Nie J, Jonsdottir GA, Ruotti V, Stewart R, Slukvin II, Thomson JA (2007) Induced pluripotent stem cell lines derived from human somatic cells. Science 318: 1917–1920.
    [CROSSREF]
  41. Zhou X, Benson KF, Przybysz K, Liu J, Hou Y, Cherath L, Chada K (1996) Genomic structure and expression of the murine Hmgi-c gene. Nucleic Acids Res 24: 4071–4077.
    [CROSSREF]
  42. Zhu H, Shah S, Shyh-Chang N, Shinoda G, Einhorn WS, Viswanathan SR, Takeuchi A, Grasemann C, Rinn JL, Lopez MF, Hirschhorn JN, Palmert MR, Daley GQ (2010) Lin28a transgenic mice manifest size and puberty phenotypes identified in human genetic association studies. Nat Genet 42: 626–630.
    [CROSSREF]
  43. Zhu H, Shyh-Chang N, Segre AV, Shinoda G, Shah SP, Einhorn WS, Takeuchi A, Engreitz JM, Hagan JP, Kharas MG, Urbach A, Thornton JE, Triboulet R, Gregory RI, DIAGRAM Consortium, MAGIC Investigators, Altshuler D, Daley GQ (2011) The Lin28/let-7 axis regulates glucose metabolism. Cell 147: 81–94.
    [CROSSREF]

EXTRA FILES

COMMENTS