First report of the dagger nematode Xiphinema pachtaicum on onion in Morocco


Share / Export Citation / Email / Print / Text size:

Journal of Nematology

Society of Nematologists

Subject: Life Sciences


ISSN: 0022-300X
eISSN: 2640-396X





Volume / Issue / page

Related articles

First report of the dagger nematode Xiphinema pachtaicum on onion in Morocco

Fouad Mokrini * / Abdelfattah Dababat

Keywords : Morocco, Xiphinema pachtaicum, Detection, First report

Citation Information : Journal of Nematology. Volume 51, Pages 1-2, DOI:

License : (CC-BY-4.0)

Published Online: 27-May-2019



In 2018, during a survey in Souss region of Morocco, the dagger nematode Xiphinema pachtaicum was found parasitizing onion, (Allium cepa L.). The populations of dagger nematode were identified on the basis of their morphological and morphometric characters and by sequencing and analysing the D2D2 region of 28S rRNA. Microscopic observation of females demonstrated the occurrence of Xiphinema pachtaicum on onion. The 28S D2D3 sequences shared 99 to 100% similarity with sequence corresponding to X. pachtaicum in GenBank. To our knowledge this is the first report of Xiphinema pachtaichum infecting onion in Morocco.

Graphical ABSTRACT

Nematodes of the genus Xiphinema are ectoparasites that feed on extensive range of hosts. Some species of this genus are economically important pests of agricultural plants and others are vectors of Nepovirus. In April 2018, during a survey, specimens of dagger nematode (Xiphinema spp.) were collected from soil around the rhizosphere of onion (Allium cepa L.) with poor growth appearance and low yield from Ouled Dahou, Souss-Massa region of Morocco (Fig. 1). Nematodes were extracted from soil using a modified Baermann technique (Hooper, 1990). On an average, nine nematodes per 100 cm3 soil were obtained. The collected nematodes were subjected to morphological and molecular characterization. All specimens were identified as Xiphinema pachtaicum based on the alpha-numeric polytomous identification key codes developed by Lamberti et al. (2002). The females had a body forming a close C after fixation. Lip region was distinctly offset by constriction. Odontostyle was robust and odontophore had weak flanges. Morphometric measurements of Xiphinema pachtaicum are listed in Table 1. The morphometric data of described Moroccan specimens were perfectly fit within the two populations of Xiphinema pachtaicum recorded by Orlando et al. (2016) from Italy.

Table 1.

Morphometric measurements of Xiphinema pachtaichum.

Figure 1:

Xiphinema pachtaicum damage symptoms on onion plants include stunting of plants and yellowing of leaves.


To confirm the identity of X. pachtaicum, DNA was extracted from single females (n = 2) by using the protocol described by Holterman et al. (2006). Two primers were used: forward D2a (5′ ACAAGTACCGTGAGGGAAAGTTG 3′) and reverse D3b (5′ TGCGAAGGAACCAGCTACTA 3′) for the amplification of the D2D3 region of 28S rRNA (Nunn, 1992). The PCR products (represented by accession Nos. MK622911 and MK622912) were sequenced, aligned and compared with published sequences by means of BLAST search in the database. The comparison revealed 99 to 100% similarity, with sequence corresponding to X. pachtaicum and 97% or less sequence similarity with other Xiphinema spp. To our knowledge, this is the first report of X. pachtaicum parasitizing onion in Morocco.


  1. Holterman, M., van der Wurff, A., van den Elsen, S., van Megen, H., Bongers, T., Holovachov, O., Bakker, J. and Helder, J.. 2006. Phylum-wide analysis of SSU rDNA reveals deep phylogenetic relationships among nematodes and accelerated evolution toward crown clades. Molecular Biology and Evolution 23: 1792–1800.
  2. Hooper, D. J.. 1990. Extraction and processing of plant and soil nematodes, in Luc, M., Sikora, R. A. and Bridge, J.. (Eds), Plant Parasitic Nematodes in Subtropical and Tropical Agriculture. CAB International, Wallingford, UK, pp. 45–68.
  3. Lamberti, F., Molinari, S., Moens, M. and Brown, D. J. F.. 2002. The Xiphinema americanum-group. II. Morphometric relationships. Russian Journal of Nematology 10: 99–112.
  4. Nunn, G. B.. 1992. Nematode molecular evolution: an investigation of evolutionary patterns among nematodes based upon DNA sequences. PhD thesis, University of Nottingham, Nottingham.
  5. Orlando, V., Chitambar, J. J., Dong, K., Chizhov, V. N., Mollov, D., Bert, W. and Subbotin, S. A.. 2016. Molecular and morphological characterisation of Xiphinema americanum-group species (Nematoda: Dorylaimida) from California, USA, and other regions, and co-evolution of bacteria from the genus Candidatus Xiphinematobacter with nematodes. Nematology 18: 1015–1043.


Figure 1:

Xiphinema pachtaicum damage symptoms on onion plants include stunting of plants and yellowing of leaves.

Full Size   |   Slide (.pptx)


  1. Holterman, M., van der Wurff, A., van den Elsen, S., van Megen, H., Bongers, T., Holovachov, O., Bakker, J. and Helder, J.. 2006. Phylum-wide analysis of SSU rDNA reveals deep phylogenetic relationships among nematodes and accelerated evolution toward crown clades. Molecular Biology and Evolution 23: 1792–1800.
  2. Hooper, D. J.. 1990. Extraction and processing of plant and soil nematodes, in Luc, M., Sikora, R. A. and Bridge, J.. (Eds), Plant Parasitic Nematodes in Subtropical and Tropical Agriculture. CAB International, Wallingford, UK, pp. 45–68.
  3. Lamberti, F., Molinari, S., Moens, M. and Brown, D. J. F.. 2002. The Xiphinema americanum-group. II. Morphometric relationships. Russian Journal of Nematology 10: 99–112.
  4. Nunn, G. B.. 1992. Nematode molecular evolution: an investigation of evolutionary patterns among nematodes based upon DNA sequences. PhD thesis, University of Nottingham, Nottingham.
  5. Orlando, V., Chitambar, J. J., Dong, K., Chizhov, V. N., Mollov, D., Bert, W. and Subbotin, S. A.. 2016. Molecular and morphological characterisation of Xiphinema americanum-group species (Nematoda: Dorylaimida) from California, USA, and other regions, and co-evolution of bacteria from the genus Candidatus Xiphinematobacter with nematodes. Nematology 18: 1015–1043.