Search

  • Select Article Type
  • Abstract Supplements
  • Blood Group Review
  • Call to Arms
  • Communications
  • Hypothesis
  • In Memoriam
  • Interview
  • Introduction
  • Letter to the Editor
  • Short Report
  • abstract
  • Abstracts
  • Article
  • book-review
  • case-report
  • case-study
  • Clinical Practice
  • Commentary
  • Conference Presentation
  • conference-report
  • congress-report
  • Correction
  • critical-appraisal
  • Editorial
  • Editorial Comment
  • Erratum
  • Events
  • in-memomoriam
  • Letter
  • Letter to Editor
  • mini-review
  • minireview
  • News
  • non-scientific
  • Obituary
  • original-paper
  • original-report
  • Original Research
  • Pictorial Review
  • Position Paper
  • Practice Report
  • Preface
  • Preliminary report
  • Product Review
  • rapid-communication
  • Report
  • research-article
  • Research Communicate
  • research-paper
  • Research Report
  • Review
  • review -article
  • review-article
  • review-paper
  • Review Paper
  • Sampling Methods
  • Scientific Commentary
  • serologic-method-review
  • short-communication
  • short-report
  • Student Essay
  • Varia
  • Welome
  • Select Journal
  • Polish Journal Of Microbiology
  • Journal Of Nematology

 

research-article | 06-June-2019

Phylogenetic studies on three Helicotylenchus species based on 28S rDNA and mtCOI sequence data

process as well as to delineate more phylogenetically distant species, which share the same morphology (cryptic species), the support of a molecular approach is needed. To date, only about 20% of Helicotylenchus species has been molecularly characterized using mostly ribosomal DNA fragments (18S, ITS, 28S rDNA; GenBank resources). Mitochondrial cytochrome c oxidase subunit I (mtCOI) sequences were reported for one species, the recently described H. oleae (Palomares-Rius et al., 2018), and a cytochrome

K. Rybarczyk-Mydłowska, E. Dmowska, K. Kowalewska

Journal of Nematology, Volume 51 , 1–17

research-article | 30-November-2019

First report of Paratylenchus lepidus Raski, 1975 associated with green tea (Camellia sinensis (L.) Kuntze) in Vietnam

, measurements and pictures were taken using Carl Zeiss Axio Lab. A1 light microscope equipped with a Zeiss Axiocam ERc5s digital camera. For molecular characterization, the D2-D3 region of 28S rDNA and COI mtDNA gene were amplified using D2A/D3B (5′–ACAAGTACCGTGGGGAAAGTTG–3′/5′–TCGGAAGGAACCAGCTACTA–3′) (Subbotin et al., 2006) and JB3/JB4 (5′-TTTTTTGGGCATCCTGAGGTTTAT-3′/5′-TAAAGAAAGAACATAATGAAAATG-3′) (Nguyen et al., 2019b) primers. Forward and reverse sequences were assembled using Geneious R11

Thi Mai Linh Le, Huu Tien Nguyen, Thi Duyen Nguyen, Quang Phap Trinh

Journal of Nematology, Volume 52 , 1–4

research-article | 30-November-2018

Morphological and Molecular Characterization of Coslenchus paramaritus n. sp. and C. cancellatus (Cobb, 1925) Siddiqi, 1978 (Nematoda: Tylenchidae) from Iran

microscope eye-piece camera in conjunction with its Dino Capture version 2.0 software. Specimens were identified at species level using available identification keys (Geraert, 2008). DNA extraction, PCR and sequencing Nematode DNA was extracted from single individuals and stored at −20°C until used as PCR template. DNA extraction was performed using the protocols described by Tanha Maafi et al. (2003). The D2–D3 expansion fragments of 28S rRNA were amplified using the forward D2A (5

Manouchehr Hosseinvand, Ali Eskandari, Reza Ghaderi

journal of nematology, Volume 51 , 1–10

Research Article | 03-September-2018

Description of Longidorus azarbaijanensis n. sp. (Dorylaimida: Longidoridae) from Iran

. sturhani. The morphological differences of the new species with the aforementioned species are discussed. For all the aforementioned species (except L. protae, currently lacking molecular data) the differences of the new species was also confirmed with differences in molecular sequences of D2-D3 expansion domains of 28S rDNA and the corresponding phylogenetic analyses. The partial sequence of the internal transcribed spacer 1 (ITS1) of the new species was also used in phylogenetic analyses. In partial

Farshad Gharibzadeh, Ebrahim Pourjam, Majid Pedram

Journal of Nematology, Volume 50 , ISSUE 2, 207–218

Research Article | 03-September-2018

Stauratostoma shelleyi n. gen., n. sp. (Nematoda: Rhabditida: Thelastomatidae) from Appalachian Polydesmid Millipedes (Polydesmida: Xystodesmidae)

stomatal opening formed from four flaps; greatly expanded labial disc; and eight-sectored annule-like column supporting the labial disc. Thirteen nematodes from various hosts were sequenced for 28S LSU rDNA and compared with other millipede-inhabiting nematodes. Stauratostoma shelleyi is the sister group to the few Thelastoma spp. that have been molecularly characterized using the D2–D3 expansion segments of the 28S LSU rDNA.

Gary Phillips, Robert J. Pivar, Xiocaun Sun, John K. Moulton, Ernest C. Bernard

Journal of Nematology, Volume 50 , ISSUE 2, 133–146

research-article | 30-November-2019

First report of Xiphinema hunaniense Wang & Wu, 1992 (Nematoda: Longidoridae) in Vietnam

. A1 light microscope equipped with a Zeiss Axiocam ERc5s digital camera. For molecular characterization, the 5′-end region of 28S rDNA was amplified using DP391/501 primers (5′-AGCGGAGGAAAAGAAACTAA-3′/5′-TCGGAAGGAACCAGCTACTA-3′) following Nguyen et al. (2019b). Forward and reverse sequences were assembled and analyzed using Geneious R11 (Nguyen et al., 2019b, 2019c). The best fit model was chosen using Mega 7 following Nguyen et al. (2019b). Results and discussion Measurements Eight females: L

Huu Tien Nguyen, Thi Duyen Nguyen, Thi Mai Linh Le, Quang Phap Trinh

Journal of Nematology, Volume 52 , 1–4

research-article | 30-November-2020

First report and new molecular and morphological characterizations of root-knot nematode, Meloidogyne javanica, infecting ginger and long coriander in Vietnam

slides following Nguyen et al. (2019). For morphological characterization, measurements and pictures were taken from permanent slides using Carl Zeiss Axio Lab. A1 light microscope equipped with a Zeiss Axiocam ERc5s digital camera. For molecular characterization, Multiplex-PCR using primers Mi2F4/Mi2R1, Far/Rar, and Fjav/Rjav was performed following Kiewnick et al. (2013) to quickly identify M. javanica from closely related species in the tropical root-knot nematode group. The D2-D3 region of 28S

Ke Long Phan, Thi Mai Linh LE, Huu Tien Nguyen, Thi Duyen Nguyen, Quang Phap Trinh

Journal of Nematology, Volume 53 , 1–8

Article | 04-December-2017

Description of a New Anguinid Nematode, Nothotylenchus phoenixae n. sp. (Nematoda: Anguinidae) Associated with Palm Date Trees and Its Phylogenetic Relations within the Family Anguinidae

sac well developed, 15 (14 to 17) mm long, female tail elongate-conoid with pointed terminus; and male with adanal bursa and spicules 21 to 22 mm long (n = 2). The new species comes close in morphology and morphometrics to five known species of the genus, namely N. affinis, N. hexaglyphus, N. persicus, N. taylori, and N. uniformis. Molecular analyses of the partial 18S, D2/D3 expansion segments of the partial 28S and internal transcribed spacer (ITS) revealed this as a new species. The sequences

MEHRAB ESMAEILI, RAMIN HEYDARI, WEIMIN YE

Journal of Nematology, Volume 49 , ISSUE 3, 268–275

research-article | 30-November-2020

Discopersicus hexagrammatus n. sp. (Rhabditida: Tylenchidae), the second species of the genus

Tanha Maafi et al. (2003), and used as template for polymerase chain reaction (PCR). The D2-D3 expansion segments of 28S rDNA were amplified using the forward D2A (5′-ACAAGTACCGTGAGGGAAAGTTG-3′) and reverse D3B (5′-TCGGAAGGAACCAGCTACTA-3′) primers (Nunn, 1992). Each PCR reaction mixure with a final volume of 30 μl, contained: 15 μl Taq DNA Polymerase 2x Master Mix RED (Ampliqon, Denmark), 1 μl (10 pmol μl−1) of each forward and reverse primers, 2 μl of DNA template and 11 μl deionised water

Manouchehr Hosseinvand, Ali Eskandari, Joaquín Abolafia, Reza Ghaderi

journal of Nematology, Volume 53 , 1–10

Article | 21-July-2017

Description of Enchodorus yeatsi n. sp. (Dorylaimida, Nordiidae) from Southern Iran and Its Molecular Phylogenetic Study

sequences of 28S rDNA D2/D3 and internal transcribed spacer 1 (ITS1) fragments. Compared to Enchodorus neodolichurus, it has basic differences in tail characters and spicule lengths. Molecular phylogenetic studies using partial sequences of 28S rDNA D2/D3 fragment of the new species and available sequences of Nordiidae members and several other dorylaim species/genera, revealed E. yeatsi n. sp. and E. dolichurus forming a clade with 0.81 Bayesian posterior probability (BPP). This

MAJID PEDRAM

Journal of Nematology, Volume 49 , ISSUE 1, 21–26

Research Article | 17-October-2018

Morphological and Molecular Characterization of Labrys filiformis n. sp. (Rhabditida: Tylenchidae) from Iran

duct, offset spermatheca filled with small spheroid sperm cells, 106 to 127 µm long elongate-conoid tail with filiform distal region and finely rounded tip. Molecular phylogenetic analyses were performed using a near-full length fragment of the 18S rDNA and the D2–D3 expansion segments of the 28S rDNA using Bayesian inference and maximum likelihood methods. In the inferred phylogenetic tree with 18S rDNA, the new species has a close affinity with several isolates of the type species, Labrys

Yousef Panahandeh, Joaquín Abolafia, Ebrahim Pourjam, Robin M. Giblin-Davis, Farahnaz Jahanshahi Afshar, Majid Pedram

Journal of Nematology, Volume 50 , ISSUE 3, 343–354

research-article | 30-November-2020

Report of the Parana coffee root-knot nematode, Meloidogyne paranaensis (Tylenchida: Meloidogynidae) from Caladium sp. in the continental United States

protocol. DNA extraction and PCR protocols were as described by Subbotin (2021). The following primer sets were used in this study: (i) the forward D2A (5′-ACA AGT ACC GTG AGG GAA AGT TG-3′) and the reverse D3B (5′-TCG GAA GGA ACC AGC TAC TA-3′) amplifying the D2–D3 expansion segments of 28S rRNA gene; (ii) the forward NAD5F2 (5′-TAT TTT TTG TTT GAG ATA TAT TAG-3′) and the reverse NAD5R1 (5′-CGT GAA TCT TGA TTT TCC ATT TTT-3′) amplifying the partial mitochondrial nad5 gene; (iii) the forward C2F3 (5

Sergei A. Subbotin, Julie Burbridge

Journal of Nematology, Volume 53 , 1–6

Article | 21-July-2017

Paurodontella parapitica n. sp. (Nematoda: Hexatylina, Sphaerularioidea) from Kermanshah Province, Western Iran

inner incisures weakly crenated, excretory pore situated 90 to 100 mmfrom anterior end; functional males common in the population, with spicules 24 to 26 mmlong. Tail of both sexes similar, almost straight and elongate-conoid. The new species resembles in morphology and morphometrics to four known species of the genus, namely P. apitica, P. minuta, P. myceliophaga, and P. sohailai. The results of phylogenetic analyses based on sequences of D2/D3 expansion region of 28S rRNA gene

MEHRAB ESMAEILI, RAMIN HEYDARI, WEIMIN YE

Journal of Nematology, Volume 48 , ISSUE 2, 109–115

research-article | 02-April-2019

Description of Oscheius indicus n. sp. (Rhabditidae: Nematoda) from India

dried in carbon dioxide. Dried specimens were mounted on stubs, coated with 20 nm gold and observed in a scanning electron microscope (Joel JSM-6510) at 15 KV. For characterization of the ITS and 28S D2/D3 sequences for molecular taxonomy, a single nematode was taken in 25 µl of sterile water in a 0.2 ml PCR tube to which 25 µl of lysis buffer (0.2 M NaCl + 0.2 M Tris-HCl (pH 8.0) + 1% (v/v) β-mercaptoethanol + 800 µg/ml proteinase K) was added (Holterman et al., 2006). The lysis was carried out in

Puneet Kumar, Wajih Jamal, Vishal S. Somvanshi, Khushbu Chauhan, Sabia Mumtaz

Journal of Nematology, Volume 51 , 1–11

Research Article | 26-September-2018

First Reports, Morphological, and Molecular Characterization of Longidorus caespiticola and Longidorus poessneckensis (Nematoda: Longidoridae) from Ukraine

processed to glycerol and mounted on permanent slides and subsequently identified morphologically and molecularly. Nematode DNA was extracted from single individuals and PCR assays were conducted as previously described for D2–D3 expansion segments of 28S rRNA. Sequence alignments for D2–D3 from L. caespiticola showed 97%–99% similarity to other sequences of L. caespiticola deposited in GenBank from Belgium, Bulgaria, Czech Republic, Russia, Slovenia, and Scotland. Similarly, D2–D3 sequence alignments

SOLOMIA SUSULOVSKA, PABLO CASTILLO, ANTONIO ARCHIDONA-YUSTE

Journal of Nematology, Volume 49 , ISSUE 4, 396–402

research-article | 30-March-2020

Characterization of Vittatidera zeaphila (Nematoda: Heteroderidae) from Indiana with molecular phylogenetic analysis of the genus

, 0.2 mM dNTPs, 1U Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA), 3 µl nematode DNA extract, and supplied enzyme reaction buffer in a total volume of 25 µl. Cycling included one step of 95°C for 2 min, followed by 35 cycles of 95°C for 30 sec, 55°C for 30 sec, and 72°C for 90 sec, finished with one cycle at 72°C for 5 min (Skantar et al., 2007). 28S: Amplification of the 28S large ribosomal subunit (LSU) D2-D3 expansion segment included the primers D2A [5′-ACAAGTACCGTGAGGGAAAGTT-3′] and D3B

Andrea M. Skantar, Zafar A. Handoo, Mihail R. Kantor, Lynn K. Carta, Jamal Faghihi, Virginia Ferris

Journal of Nematology, Volume 52 , 1–8

research-article | 30-November-2020

Description of Longidorella (Saevadorella) caspica n. sp. (Dorylaimida: Nordiidae) from north Iran

adding 15 μl TE buffer. The DNA sample was stored at −20°C. Primers for 28S rDNA D2-D3 amplification/sequencing were forward primer D2A (5´-ACAAGTACCGTGAGGGAAAGT-3´) and reverse primer D3B (5´-TCGGAAGGAACCAGCTACTA-3´) (Nunn, 1992). The PCR cycles and sequencing of amplified fragments were according to Jahanshahi Afshar et al. (2019) and sequenced directly for both strands using the same primers with an ABI 3730XL sequencer (Bioneer Corporation, South Korea). The newly generated sequence for the new

Fariba Heydari, Mohammad Reza Atighi, Ebrahim Pourjam, Majid Pedram

Journal of Nematology, Volume 53 , 1–11

research-article | 30-November-2018

Molecular and morphological characterization of Paurodontella composticola n. sp. (Nematoda: Hexatylina, Sphaerulariidae) from Iran

(Caparica, Portugal). The newly obtained sequence was submitted to the GenBank database under accession number MH427864 for partial 28S D2/D3 rDNA. Phylogenetic analyses The molecular sequence of Purodontella composticola n. sp. was compared with those of other nematode species available in GenBank using the BLAST homology search program. Our newly obtained DNA sequence was edited with ChromasPro1.5 2003-2009 (Technelysium Pty Ltd, Helensvale, Australia) and aligned using ClustalW (http

Mehrab Esmaeili, Ramin Heydari, Ahmad Kheiri, Weimin Ye

Journal of Nematology, Volume 51 , 1–12

Research Article | 03-September-2018

Molecular Characterization and Phylogeny of Ditylenchus weischeri from Cirsium arvense in the Prairie Provinces of Canada

molecular analysis of many D. weischeri specimens from Canada is presented. Individuals from 41C. arvense or yellow pea grain samples with seeds of C. arvense from the Prairie Provinces were sequenced for the internal transcribed spacer (ITS rDNA), large subunit (LSU) D2D3 28S rDNA, partial segment of small subunit (SSU) 18S rDNA, and the heat shock protein Hsp90 gene. The analysis also included D. weischeri individuals from C. arvense from Russia and garlic with D. dipsaci from the Provinces of Ontario

Mehrdad Madani, Mario Tenuta

Journal of Nematology, Volume 50 , ISSUE 2, 163–182

research-article | 30-November-2019

On the identity of Eucephalobus oxyuroides (de Man, 1876) Steiner, 1936 (Rhabditida, Cephalobidae), with an updated taxonomy of the genus and notes about its phylogeny

microscopy (SEM) Specimens preserved in glycerine were selected for observation under SEM according to the methods of Abolafia (2015). They were hydrated in distilled water, dehydrated in a graded ethanol-acetone series, critical point dried, coated with gold, and observed with a Zeiss Merlin microscope (5 kV) (Zeiss, Oberkochen, Germany). Phylogenetic analyses For phylogenetic relationships, analyses were based on 18S and 28S rDNA gene sequences available in GenBank. The sequences were aligned using

Joaquín Abolafia, Reyes Peña-Santiago

Journal of Nematology, Volume 52 , 1–20

research-article | 30-November-2019

Morphological and molecular characterization of Heterodera dunensis n. sp. (Nematoda: Heteroderidae) from Gran Canaria, Canary Islands

field differentiation, tail length, and hyaline tail length in J2 (Subbotin et al., 2010). Since the last two decades, employing molecular data such as ITS and 28S of ribosomal DNA and COI gene of mitochondrial DNA to characterize Heterodera species has been a common practice, including DNA barcoding, phylogeny, and even phylogeography (Ferris et al., 1999; Toumi et al., 2013a; Subbotin et al., 2017, 2018). Herein, we characterize Heterodera dunensis n. sp. discovered in a recent exploratory survey

Phougeishangbam Rolish Singh, Gerrit Karssen, Marjolein Couvreur, Wim Bert

Journal of Nematology, Volume 52 , 1–14

research-article | 30-November-2018

Morphological and Molecular Characterization of Oscheius saproxylicus sp. n. (Rhabditida, Rhabditidae) From Decaying Wood in Spain, With New Insights into the Phylogeny of the Genus and a Revision of its Taxonomy

centrifuged to 13,000 r.p.m. (or 15,900 × g) for 3 min. and 2 μl of the supernatant extracted DNA was transferred to a microtube containing: 2.5 μl ×10 PCR reaction buffer, 5 μl Q-solution ×5, 0.5 μl dNTPs mixture (10 mM each), 1 μl of each primer (10 mM), 0.2 μl Taq DNA Polymerase (Qiagen, Venlo, The Netherlands) and ddH2O to a final volume of 25 μl. The primers used for amplification of the D2-D3 region of 28S rRNA gene were the D2A (5′-ACAAGTACCGTGAGGGAAAGTTG-3′) and the D3B (5′-TCGGAAGGAACCAGCTACTA-3

Joaquín Abolafia, Reyes Peña-Santiago

journal of nematology, Volume 51 , 1–21

research-article | 30-November-2019

Molecular characterization of the Pratylenchus vulnus populations on cereals in Turkey

Vovlas, 2007). Molecular techniques as RAPD-PCR and sequencing of D2 to D3 expansion segments of the 28S rRNA was used for the identification of P. vulnus on different plant species (Subbotin et al., 2008; Bakooie et al., 2012; Lopez-Nicora et al., 2012). Moreover, real-time PCR provides sensitive identification of the species with species-specific primers using 1/128 of the DNA of one nematode (Huang and Yan, 2017). Pratylenchus vulnus (Allen and Jensen, 1951) (walnut root lesion nematode) has been

Mehmet Sait Karaca, Elif Yavuzaslanoglu, Gul Imriz, Ozlem Ates Sonmezoglu

Journal of Nematology, Volume 52 , 1–4

research-article | 30-November-2020

Morphological and molecular characterization of Xiphinemella esseri Chitwood, 1957 (Dorylaimida: Leptonchidae) from Florida, with the first molecular study of the genus

250D digital camera (Canon, Tokyo, Japan). Digital images were edited using Adobe® Photoshop® CS (Adobe Systems, San Jose, CA). DNA extraction, PCR, sequencing, and phylogenetic analysis DNA was extracted from single individuals using the proteinase K protocol. DNA extraction, PCR, and cloning protocols were used as described by Tanha Maafi et al. (2003). The primers used for amplification of the D2-D3 expansion segments of 28S rRNA gene were the D2A (5′-ACA AGT ACC GTG AGG GAA AGT TG-3′) and the

Sergio Álvarez-Ortega, Sergei A. Subbotin, Renato N. Inserra

Journal of Nematology, Volume 53 , 1–9

research-article | 14-December-2020

Morphological, morphometrical, and molecular characterization of Metarhabditis amsactae (Ali, Pervez, Andrabi, Sharma and Verma, 2011) Sudhaus, 2011 (Rhabditida, Rhabditidae) from India and proposal of Metarhabditis longicaudata as a junior synonym of M. amsactae

′ (reverse) (Vrain et al., 1992). The fragment containing the D2/D3 regions of the 28S rDNA gene was amplified using primers D2F: 5′-CCTTAGTAACGGCGAGTGAAA-3′ (forward) and 536: 5′-CAGCTATCCTGAGGAAAC-3′ (reverse) (Nadler et al., 2006). The 18S rDNA was amplified using primers NEM18SF: 5′-CGCGAATRGCTCATTACAACAGC-3′ (forward) and NEM18SR: 5′-GGGCGGTATCTGATCGCC-3′ (reverse) (Floyd et al., 2005). The Polymerase Chain Reaction (PCR) protocol for ITS, 18S, and D2/D3 rDNA gene amplification followed was

Aashaq Hussain Bhat, Shreyansh Srivastava, Aasha Rana, Ashok Kumar Chaubey, Ricardo A. R. Machado, Joaquín Abolafia

Journal of Nematology, Volume 52 , 1–23

research-article | 25-May-2020

Description and molecular phylogeny of Mesocriconema abolafiai n. sp. (Nematoda: Criconematidae) from Iran

For DNA amplification the protocol described by Tanha Maafi et al. (2003) was used. The D2 to D3 expansion regions of the 28S rRNA gene was amplified with the forward D2A (5´-ACAAGTACCGTGAGGGAAAGTTG-3´) and the reverse D3B (5´-TCGGAAGGAACCAGCTACTA-3´) primers (Nunn, 1992). The 18S rRNA was amplified as two partially overlapping fragments, using three universal and one nematode-specific primer (1912R). First 18S fragment forward primer 988F (5´-CTCAAAGATTAAGCCATGC-3´) and reverse primer 1912R (5

Hossein Mirbabaei Karani, Ali Eskandari, Reza Ghaderi, Akbar Karegar

Journal of Nematology, Volume 52 , 1–17

research-article | 01-October-2021

Redescription and phylogenetic analysis of the type species of the genus Panagrellus Thorne, 1938 (Rhabditida, Panagrolaimidae), P. pycnus Thorne, 1938, including the first SEM study

primer (10 mM), 3 μ l Master Mix Taq DNA Polymerase (5x Hot FirePol Blend Master Mix) and ddH2O to a final volume of 20 μ l. The primers used for amplification of the region of 18S rRNA gene were the forward primer SSU F_04 (5′-GCTTGTCTCCAAAGATTAAGCC-3′) and the reverse primer SSU R_26 (5′-CATTCTTGGCAAATGCTTTCG-3′) (Blaxter et al., 1998). The primers used for amplification of the D2-D3 region of 28S rRNA gene were the forward primer D2A (5′-ACAAGTACCGTGAGGGAAAGTTG-3′) and the reverse primer D3B (5

Joaquín Abolafia, Matteo Vecchi

Journal of Nematology, Volume 53 , 1–20

research-article | 30-November-2020

Morphological and molecular characterisation of Longidorus pauli (Nematoda: Longidoridae), first report from Greece

objective of the present study was to provide an accurate identification of Longidorus species detected in North Greece by an integrative approach of morphological and molecular characterization by using the D2-D3 expansion segments of 28S rRNA, ITS1 rRNA, and partial mitochondrial coxI regions. Materials and methods Nematode samples and morphological study Soil samples were collected at a depth of 20 to 40 cm from the rhizosphere of a grapevine grafted on 1103-Paulsen of the Institute of Plant

Emmanuel A. Tzortzakakis, Ilenia Clavero-Camacho, Carolina Cantalapiedra-Navarrete, Parthenopi Ralli, Juan E. Palomares-Rius, Pablo Castillo, Antonio Archidona-Yuste

Journal of Nematology, Volume 53 , 1–10

Article | 21-July-2017

Molecular and Morphological Characterization of Xiphinema chambersi Population from Live Oak in Jekyll Island, Georgia, with Comments on Morphometric Variations

rounded and set off from head; total stylet length 170 to 193 mm; vulva at 20.4% to 21.8% of body length; a monodelphic, posterior reproductive system; elongate, conoid tail with a blunt terminus and four pairs of caudal pores, of which two pairs are subdorsal and two subventral. Sequence data from the D2–D3 region of the 28S rRNA molecule subjected to GenBank sequence comparison using BLAST showed that the sequence had 96% and 99% similarity with X. chambersi from Alabama

ZAFAR A. HANDOO, LYNN K. CARTA, ANDREA M. SKANTAR, SERGEI A. SUBBOTIN, STEPHEN W. FRAEDRICH

Journal of Nematology, Volume 48 , ISSUE 1, 20–27

research-article | 27-May-2019

Description of Geocenamus vietnamensis sp. n. (Nematoda: Merliniidae) from Vietnam

. (1999). Primers for D2–D3 of 28S rDNA amplification were D2A (59-ACAAGTACCGTGGGGAAAGTTG-39) and D3B (59-TCGGAAGGAACCAGCTACTA-39) (Subbotin et al., 2006). Primers for ITS rDNA amplification were modified from Vrain et al. (1992): VRAIN 2F (59-CTTTGTACACACCGCCCGTCGCT-39) and VRAIN 2R (59-TTTCACTCGCCGTTACTAAGGGAATC-39). Phylogenetic analyses The BLAST homology search program was used to search for closely related species on GenBank. The sequence data set was aligned with the ClustalW software

Huu Tien Nguyen, Thi Mai Linh Le, Thi Duyen Nguyen, Gracia Liebanas, Thi Anh Duong Nguyen, Quang Phap Trinh

Journal of Nematology, Volume 51 , 1–12

research-article | 30-November-2019

Plant-parasitic nematodes associated with sugarcane in Kilimanjaro, Tanzania

data by taking pictures and measurements using the above camera-equipped microscope. This was followed by DNA extraction from individual nematodes as described in the study of Singh et al. (2018) and the resulting genomic DNA sample was used for the amplification of the partial ITS and D2-D3 region of the 28S of rRNA gene and the COI gene of mtDNA. PCR amplification of the partial ITS was done using the primer pair Vrain2F: 5´-CTTTGTACACACCGCCCGTCGCT-3´/Vrain2R: 5´-TTTCACTCGCCGTTACTAAGGGAATC-3

Phougeishangbam Rolish Singh, Beatrice E. Kashando, Marjolein Couvreur, Gerrit Karssen, Wim Bert

Journal of Nematology, Volume 52 , 1–17

research-article | 22-February-2021

Rotylenchus wimbii n. sp. (Nematoda: Hoplolaimidae) associated with finger millet in Kenya

accepted and its widespread use has also recently been facilitated by a web-based key that draws its basis from cluster analysis (Nguyen et al., 2019). In combination with the morphological features, molecular information such as ITS, 18S, and 28S of ribosomal DNA and COI of mitochondrial DNA have been used for their identification. In the current paper, we characterize a newly discovered Rotylenchus wimbii n. sp. found associated with finger millet, Eleusine coracana (L.) Gaertn. (Planta: Poaceae) in

Phougeishangbam Rolish Singh, Gerrit Karssen, Kelvin Gitau, Cecilia Wanjau, Marjolein Couvreur, Njira Njira Pili, Godelieve Gheysen, Wim Bert

Journal of Nematology, Volume 53 , 1–14

research-article | 03-June-2019

PCR amplification of a long rDNA segment with one primer pair in agriculturally important nematodes

Eukaryotic nuclear ribosomal DNA (rDNA) is arranged in tandem repeat arrays in the genome. Each repeat unit consists of one copy of small subunit (SSU) 18S, internal transcribed spacers (ITS1 and ITS2), 5.8S, and large subunit (LSU) 28S rDNA, and is separated by an external transcribed spacer (EST) and an intergenic spacer (IGS) (Hillis and Dixon, 1991). The copy number of the repeats within most eukaryotic genomes is high, which provide large quantities of template DNA for PCR. In

L. K. Carta, S. Li

Journal of Nematology, Volume 51 , 1–8

research-article | 24-April-2019

Description of Rotylenchus rhomboides n. sp. and a Belgian population of Rotylenchus buxophilus (Tylenchomorpha: Hoplolaimidae)

morphology and morphometrics along with molecular characteristics and phylogeny of the D2-D3 expansion segment of 28S rDNA, ITS rDNA, and COI mtDNA sequences. Materials and methods Sampling and nematode extraction The soil and root samples were collected around the rhizosphere of banana (Musa basjoo Siebold & Zucc. ex Iinuma) (GPS coordinates N: 51°2′6.8″, E: 3°43′22.7″) and Yam (Dioscorea tokoro) (GPS coordinates: N: 51°2′6.9″, E: 3°43′22.6″) at the Botanical garden of Ghent University. The nematodes

Huu Tien Nguyen, Quang Phap Trinh, Marjolein Couvreur, Phougeishangbam Rolish Singh, Wilfrida Decraemer, Wim Bert

Journal of Nematology, Volume 51 , 1–20

research-article | 30-November-2020

Description of Spinocephalus tessellatus n. gen., n. sp. (Rhabditida, Cephalobidae) from Iran, a nematode with a new morphological pattern at lip region

DNA was transferred to a microtube containing: 0.6 μl of each primer (10 mM), 3 μl Master Mix Taq DNA Polymerase (5x Hot FirePol Blend Master Mix) and ddH2O to a final volume of 20 μl. The primers used for amplification of the region of 18S rRNA gene were the forward primer SSU F_04 (5′-GCTTGTCTCCAAAGATTAAGCC-3′) and the reverse primer SSU R_26 (5′-CATTCTTGGCAAATGCTTTCG-3′) (Blaxter et al., 1998). The primers used for amplification of the D2-D3 region of 28S rRNA gene were the D2A (5

Joaquín Abolafia, Manouchehr Hosseinvand, Ali Eskandari

Journal of Nematology, Volume 53 , 1–16

research-article | 30-November-2020

Morphological and molecular characterization of Paratylenchus beltsvillensis n. sp. (Tylenchida: Paratylenchidae) from the rhizosphere of pine tree (Pinus virginiana Mill) in Maryland, USA

several Paratylenchus species using partial 28S rRNA gene sequences. Lopez et al. (2013) used the ITS1 rRNA gene to reconstruct paratylenchid relationships including G. bilineata Brzeski (1995) and G. aculenta (Brown, 1959; Raski, 1962). Van Den Berg et al. (2014) inferred phylogenetic relationships among several Paratylenchus spp. using 28S rRNA (58 sequences) and ITS rRNA (40 sequences) gene sequences for this genus. Wang et al. (2016a), also using the ITS rRNA gene, demonstrated that their newly

Mihail R. Kantor, Zafar A. Handoo, Sergei A. Subbotin, Gary R. Bauchan, Joseph D. Mowery

Journal of Nematology, Volume 53 , 1–10

research-article | 16-April-2019

Description of a new dagger nematode, Xiphinema barooghii n. sp. (Nematoda: Longidoridae) and additional data on the three known species of the genus from northwest of Iran

phylogenetic tree (Fig. 5). Phylogenetic analyses The newly obtained sequences were aligned using MEGA6 (Tamura et al., 2013) and compared with other Xiphinema D2–D3 expansion segment of 28S rDNA gene sequences available in GenBank using the Nblast homology search program. Longidorus helveticus (Lamberti et al., 2001) (AY601566) was chosen as out group. The best-fitted model of DNA evolution was obtained using MrModeltest 2.3 (Nylander, 2004) with the Akaike Information Criterion (AIC). Phylogenetic

Nasir Vazifeh, Gholamreza Niknam, Habibeh Jabbari, Arezoo Naghavi

Journal of Nematology, Volume 51 , 1–17

research-article | 27-May-2019

First report of the dagger nematode Xiphinema pachtaicum on onion in Morocco

and yellowing of leaves. To confirm the identity of X. pachtaicum, DNA was extracted from single females (n = 2) by using the protocol described by Holterman et al. (2006). Two primers were used: forward D2a (5′ ACAAGTACCGTGAGGGAAAGTTG 3′) and reverse D3b (5′ TGCGAAGGAACCAGCTACTA 3′) for the amplification of the D2D3 region of 28S rRNA (Nunn, 1992). The PCR products (represented by accession Nos. MK622911 and MK622912) were sequenced, aligned and compared with published sequences by means of

Fouad Mokrini, Abdelfattah Dababat

Journal of Nematology, Volume 51 , 1–2

research-article | 30-November-2020

First report of Mesocriconema sphaerocephalum (Taylor, 1936) Loof, 1989 associated with wild grass in Botswana

″) (De Ley et al., 1999), were used in the PCR reactions for partial amplification of the 18S and 28S rDNA region, respectively. PCR was conducted with 8 μl of the DNA template, 12.5 μl of 2X PCR Master Mix Red (Promega, USA) for the Botswanan specimens, 1 μl of each primer (10 pmol μl−1), and ddH2O for a final volume of 30 μl. The amplification was processed using an Eppendorf master cycler gradient (Eppendorf, Hamburg, Germany), with the following program: initial denaturation for 3 min at 94°C, 37

Ebrahim Shokoohi

Journal of Nematology, Volume 53 , 1–5

Article | 21-July-2017

Morphological and Molecular Characterization of Two Aphelenchoides Endophytic in Poplar Leaves

northwestern North America were discovered. Nematodes were identified and characterized microscopically and molecularly with 28S ribosomal RNA (rRNA) and 18S rRNA molecular markers. From P. angustifolia, Aphelenchoides saprophilus was inferred to be closest to another population of A. saprophilus among sequenced taxa in the 18S tree. From P. trichocarpa, Laimaphelenchus heidelbergi had a 28S sequence only 1 bp different from that of a Portuguese population, and 1 bp different from the

LYNN K. CARTA, SHIGUANG LI, ANDREA M. SKANTAR, GEORGE NEWCOMBE

Journal of Nematology, Volume 48 , ISSUE 1, 28–33

research-article | 06-November-2020

Morphological and molecular analyses of a Meloidogyne mali population with high intragenomic rRNA polymorphism

amplified with SSU-F-04 and SSU-R-81 (Griffiths et al., 2006), the D2-D3 region of 28S was amplified with D2A/D3B (De Ley et al., 1999) and the COI mtDNA region was amplified with the primer JB3 and JB5 (DeRycke et al., 2005). PCR reactions were done following the protocol of Ye et al. (2007) and Li et al. (2008). Amplification success and amplicon size were verified in 1.0% agarose gel stained with ethidium bromide. All the positive PCR products were sent for direct sequencing first. For COI, the

Jianfeng Gu, Yiwu Fang, Lele Liu

Journal of Nematology, Volume 52 , 1–11

Research Article | 03-December-2018

Two nematodes (Nematoda: Diplogastridae, Rhabditidae) from the invasive millipede Chamberlinius hualienensis Wang, 1956 (Diplopoda, Paradoxosomatidae) on Hachijojima Island in Japan

juvenile Oscheius rugaoensis (Zhang et al., 2012) Darsouei et al., 2014 (Rhabditidae), and juvenile and adult Mononchoides sp. (Diplogastridae) based on images, morphometrics, and sequences of 18S and 28S rDNA. A novel short 28S sequence of a separate population of Oscheius necromenus SB218 from Australian millipedes was also included in a phylogenetic comparison of what can now be characterized as a species complex of millipede-associated Oscheius. The only other nematode associates of millipedes

L. K. Carta, W. K. Thomas, V. B. Meyer-Rochow

Journal of Nematology, Volume 50 , ISSUE 4, 479–486

research-article | 30-November-2018

First report of Mesocriconema sphaerocephalum (Taylor, 1936) Loof, 1989 associated with carrot (Daucus carota subsp. Stativus) in Vietnam

Zeiss Axio Lab.A1 light microscope. Measurements and pictures were taken using a ZEN lite software on ZEISS Axiocam ERc5s digital camera (Nguyen et al., 2017). For molecular studies, Primers D2A (5′-ACAAGTACCGTGGGGAAA GTTG-3′) and D3B (5′-TCGGAAGGAACCAGCTAC TA-3′) were used to amplify D2D3 of 28S rDNA region (Nguyen et al., 2017). Obtained sequence was used for a Blast search in GenBank (Altschul et al., 1997). The data set was analyzed using maximum likelihood (ML) method in MEGA 6 program with

Thi Duyen Nguyen, Huu Tien Nguyen, Thi Mai Linh Le, Thi Tuyet Thu Tran, Neriza Nobleza, Quang Phap Trinh

Journal of Nematology, Volume 51 , 1–4

Research Article | 17-October-2018

First Report of Bitylenchus hispaniensis, Pratylenchoides alkani, and Helicotylenchus vulgaris in Association with Cultivated and Wild Olives in Crete, Greece and Molecular Identification of Helicotylenchus microlobus and Merlinius brevidens

Emmanuel A. Tzortzakakis, Carolina Cantalapiedra-Navarrete, Maria Kormpi, Maria S. Lazanaki, Pablo Castillo, Antonio Archidona-Yuste

Journal of Nematology, Volume 50 , ISSUE 3, 413–418

research-article | 30-November-2019

First report of Meloidogyne javanica infecting Zinnia elegans in Ceará State, Brazil

were prepared according to Taylor and Netscher (1974). The determination of the esterase profile was made according to Carneiro and Almeida (2001), using 20 female. For molecular identification, the D2 to D3 region of 28S rDNA segment was amplified and sequenced using the primers D2A (5′-ACAAGTACCGTGAGGGAAAGTTG-3′) and D3B (5′-TCGGAAGGAACCAGCTACTA-3′) (De Ley et al., 1999) and ITS primers with VRAIN2F (5′-CTTTGTACACACCGCCCGTCGCT-3′) and VRAIN2R (5′-TTTCACTCGCCGTTACTAAGGGAATC-3′) (Vrain et al., 1992

Francisco Jorge Carlos Souza Junior, Mayara Castro Assunção

Journal of Nematology, Volume 52 , 1–4

Article | 21-July-2017

Occurrence of Belonolaimus in Sinaloa, Northwestern Mexico: A New Report on Distribution and Host Range

to the Belonolaimus longicaudatus species complex. Molecular analyses based on the 28S gene and ITS1-5.8S-ITS2 regions of the ribosomal RNA (rRNA) identified four major clades within Belonolaimus; however, none of the species including B. longicaudatus, B. gracilis, and B. euthychilus were supported as monophyletic; yet monophyly is argued to be a basic requirement of species status. Sequence divergence among different Belonolaimus populations and species varied according to the rRNA dataset (i.e

MANUEL MUNDO-OCAMPO, J. G. BALDWIN, T. J. PEREIRA, J. R. CAMACHO-BAEZ, A. D. ARMENTA-BOJORQUEZ, M. CAMACHO-HARO, J. O. BECKER

Journal of Nematology, Volume 49 , ISSUE 1, 103–113

research-article | 30-November-2018

Serendipitous identification of Pratylenchus curvicauda from the grainbelt of Western Australia

regions of the large subunit ribosomal genes (28S), which is thought to evolve slowly, have been used to examine the evolutionary relationships among species of many genera including Pratylenchus (Al-Banna et al., 1997). Pratylenchus teres, which was previously considered to be endemic to Western Australia, has recently been re-described as Pratylenchus quasitereoides using traditional methods and sequences of the 28S-D3 region of the rDNA (Hodda et al., 2014). The latter species is reported to occur

Farhana Begum, John Fosu-Nyarko, Shashi Sharma, Bill Macleod, Sarah Collins, Michael G. K. Jones

Journal of Nematology, Volume 51 , 1–15

research-article | 30-November-2020

Detection of Pratylenchus zeae and P. brachyurus parasitizing plants from the caatinga biome, Ceará, Brazil

identification of specimens from the population of Pratylenchus was carried out by amplifying and sequencing the regions ITS primers with VRAIN2F (5´-CTTTGTACACACCGCCCGTCGCT-3´) and VRAIN2R (5´-TTTCACTCGCCGTTACTAAGGGAATC-3´) (Vrain et al., 1992) and D2-D3 of 28S rDNA segment with the primers D2A (5´-ACAAGTACCGTGAGGGAAAGTTG-3´) and D3B (5´-TCGGAAGGAACCAGCTACTA-3´) (De Ley et al., 1999). The consensus sequences were formed from the forward and reverse sequences, using the Staden package (Staden et al., 1998

Francisco Jorge Carlos Souza Junior, Mayara Castro Assunção

Journal of Nematology, Volume 53 , 1–5

research-article | 30-November-2018

New data on known species of Hirschmanniella and Pratylenchus (Rhabditida, Pratylenchidae) from Iran and South Africa

(Majd Taheri et al., 2013). Those species have been studied by morphological characters except for two unknowns which have been studied by morphological and molecular DNA barcoding using 28S rDNA (Majd Taheri et al., 2013). Root-lesion nematodes, Pratylenchus (Filipjev, 1936), are after root-knot and cyst nematodes listed as the third economically most important genus that adversely affects crop production worldwide (Castillo and Vovlas, 2007; Jones et al., 2013). Pratylenchus hippeastri, the

Ebrahim Shokoohi, Joaquín Abolafia, Phatu William Mashela, Nafiseh Divsalar

Journal of Nematology, Volume 51 , 1–26

research-article | 30-November-2020

First report of rice root-knot nematode, Meloidogyne graminicola, infecting Juncus microcephalus in Brazil

amplification and sequencing of ITS1-5.8S-ITS2 rRNA region and the D2 to D3 fragment of the 28S ribosomal RNA gene (De Ley et al., 1999; Schmitz et al., 1998). Genomic deoxyribonucleid acid (DNA) was ultimately obtained from females using the NaOH method (Stanton et al., 1998). The nematode population density observed in the sample was 1,980 J2/g of J. microcephalus roots. The J2s had the following morphometric characters: length (L) = 499.5 ± 45.0 (389.0-500.5) μm, a = 26.5 ± 1.1 (24.5-30.0), c = 5.1 ± 0.4

Cristiano Bellé, Paulo Sergio dos Santos, Tiago Edu Kaspary

Journal of Nematology, Volume 53 , 1–4

Article | 24-July-2017

Discopersicus n. gen., a New Member of the Family Tylenchidae Örley, 1880 with Detailed SEM Study on Two Known Species of the Genus Discotylenchus Siddiqi, 1980 (Nematoda; Tylenchidae) from Iran

ALI YAGHOUBI, EBRAHIM POURJAM, SERGIO A LVAREZ-ORTEGA, GRACIA LIE´BANAS, MOHAMMAD REZA ATIGHI, MAJID PEDRAM

Journal of Nematology, Volume 48 , ISSUE 3, 214–221

research-article | 24-April-2020

Mitochondrial COI gene is valid to delimitate Tylenchidae (Nematoda: Tylenchomorpha) species

sequences for the identification of Tylenchidae species; and compare the resolution, sequences variability, and tree topologies obtained from one COI and two rRNA markers (i.e. 18S and the 28S rRNA). Materials and methods Samples collection and processing Soil samples were collected in China from 2018 to 2019. The details on sampling locations and habitats were given in Table 1. The nematodes were extracted from soil samples by Baermann tray and subsequently collected by a 400 mesh sieve (37 μm

Mengxin Bai, Xue Qing, Kaikai Qiao, Xulan Ning, Shun Xiao, Xi Cheng, Guokun Liu

Journal of Nematology, Volume 52 , 1–12

research-article | 30-November-2019

Four Pristionchus species associated with two mass-occurring Parafontaria laminata populations

Natsumi Kanzaki, Minami Ozawa, Yuko Ota, Yousuke Degawa

Journal of Nematology, Volume 52 , 1–10

research-article | 31-August-2020

First report of potato rot nematode, Ditylenchus destructor Thorne, 1945 infecting Codonopsis pilosula in Gansu province, China

length: 60.2 ± 5.0 (55.5-67.7) μm, ABW = 16.5 ± 2.5 (13.4-20.1) μm. These morphological characteristics matched with Ditylenchus destructor by Thorne. (Thorne, 1945). DNA of single nematode (n = 5) was isolated using the Proteinase K method (Kumari and Subbotin, 2012) and amplification of rDNA-ITS region and D2/D3 fragments of the 28S rDNA sequencing were performed with the universal primers 18S (5′-TTGATTACGTCCCTGCCCTTT-3′) and 26S (5′-TTTCACTCGCCGTTACTAAGG-3′) (Vrain et al., 1992). D2A (5

Chunhui Ni, Shuling Zhang, Huixia Li, Yonggang Liu, Wenhao Li, Xuefen Xu, Zhipeng Xu

Journal of Nematology, Volume 52 , 1–2

Original Research | 11-December-2017

Description of Pseudacrobeles (Pseudacrobeles) curvatus sp. n. (Cephalobidae: Rhabditida) in South Korea

and diagnostic features of Pseudacrobeles species and molecular sequence data from the D2-D3 regions of the 28S ribosomal DNA (rDNA) and ITS1-5.8S-ITS2 region of rDNA from the new species, which can be used as molecular barcode sequences.  

Jiyeon Kim, Taeho Kim, Joong-Ki Park

Journal of Nematology, Volume 49 , ISSUE 2, 162–167

research-article | 30-November-2020

Morphological and molecular characterization of Bitylenchus hispaniensis (Nematoda: Telotylenchidae) from Iran

markers for species identification is very important. In the present study based on the 28S rRNA gene and ITS rRNA gene, Bitylenchus is paraphyletic. The results of the phylogenetic study by Handoo et al. (2014) indicated the monophyly for the genus Tylenchorhynchus sensu Siddiqi (2000), and monophyly for the genus Bitylenchus sensu Gómez Barcina et al. (1992) and Siddiqi (2000) was accepted after the exclusion of B. ventrosignatus from this genus. Hosseinvand et al. (2020), indicated that Bitylenchus

Abbas Abdolkhani, Sedighe Azimi

Journal of Nematology, Volume 53 , 1–10

research-article | 30-November-2018

First record of Aphelenchoides stammeri (Nematoda: Aphelenchoididae) from Turkey

for 30 sec as denaturation, annealing at 57°C for 30 sec (40 cycles), extension at 68°C for 1 min (40 cycles), and final extension at 68°C for 3 min (40 cycles). For 28S amplification, M13 D2A-28S- Forward primer: TGTAAAACGACGGCCAGTACAAGTACCGTGAGGGAAAGT M13 D3B-28S- Reverse primer: CAGGAAACAGCTATGACTGCGAAGGAACCAGCTACTA were used following the same procedure that was applied for 28S amplification step. PCR products were purified and sequenced using Sanger sequencing method. Type designation and

Mehmet Dayi, Ece B. Kasapoğlu Uludamar, Süleyman Akbulut, İ. Halil Elekcioğlu

journal of nematology, Volume 51 , 1–6

research-article | 30-November-2019

First report of Meloidogyne hapla on kiwifruit in South Africa

using CLUSTAL W (Thompson et al., 1994). The length of each alignment was 946 and 1186 bp for ITS rDNA and 28S rDNA, respectively. Bayesian inference was used to reconstruct the phylogeny, with Bayesian trees generated using the Bayesian inference method as implemented in the program MrBayes 3.1.2 (Ronquist and Huelsenbeck, 2003). The GTR + I + G model was selected using jModeltest 2.1.10 (Guindon and Gascuel, 2003; Darriba et al., 2012). Analysis using the GTR + I + G model was initiated with a

Ebrahim Shokoohi, Phatu W. Mashela

Journal of Nematology, Volume 52 , 1–5

research-article | 30-November-2019

First report of Meloidogyne naasi parasitizing turfgrass in Portugal

tip and collected in 20 μl sterilized MilliQ water and stored at −20°C (Harris et al., 1990). PCR with the species-specific primers N-ITS/R195 was performed as described in Zijlstra et al. (2004). DNA extracts from J2 of a Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 isolate were included as a negative control. An expected PCR product of ca. 430 bp was obtained and no amplification was detected for the M. incognita DNA. To confirm the identification, partial 28S sequences were

M. Clara Vieira dos Santos, M. Teresa M. Almeida, Sofia R. Costa

Journal of Nematology, Volume 52 , 1–4

research-article | 30-November-2020

Morphological and Molecular Characterization of Quinisulcius curvus from China

modified by De Grisse (1969) and mounted on permanent slides. Measurements were made on mounted specimens, light micrographs and illustrations were produced using a Zeiss microscope equipped with a Zeiss AxioCam MRm CCD camera. DNA extraction, PCR and sequencing DNA samples were prepared according to Li et al. (2008). Four sets of primers (synthesis by Invitrogen, Shanghai, China) were used in the PCR analyses to amplify sequences of the near full-length 18S region, D2-D3 expansion segments of 28S

Jianfeng Gu, Maria Munawar, Pablo Castillo, Bo Cai

Journal of Nematology, Volume 53 , 1–11

Research Article | 17-October-2018

First Report of Stubby-Root Nematode, Paratrichodorus minor, on Onion in Georgia, U.S.A

segments of 28S rRNA, and ITS1 rDNA were amplified using primer pairs 360F (5′ CTACCACATCCAAGGAAGGC 3′)/932R (5′ TATCTGATCGCTGTCGAACC 3′), D2A (5′ ACAAGTACCGTGAGGGAAAGTTG 3′)/D3B (5′ TCGGAAGGAACCAGCTACTA 3′), and BL18 (5′ CCCGTCGCTACTACCGATT 3′)/5818 (5′ ACGARCCGAGTGATCCAC 3′), respectively (Riga et al., 2007; Duarte et al., 2010; Ye et al., 2015; Shaver et al., 2016). The obtained PCR fragments were purified using QIAquick Gel Extraction Kit (Qiagen Inc., Santa Clara, CA, USA), sequenced and deposited

Abolfazl Hajihassani, Negin Hamidi, Bhabesh Dutta, Chris Tyson

Journal of Nematology, Volume 50 , ISSUE 3, 453–455

Article | 21-July-2017

Data on Some Species of the Genus Coslenchus Siddiqi, 1978 (Rhabditida, Tylenchidae) from Iran

phylogenetic studies based on partial sequences of 28S rDNA D2/D3 fragments, all species formed a clade with high Bayesian posterior probability in Bayesian inference, indicating the monophyly of the genus. The clade of Coslenchus spp. formed a highly supported monophyletic group, a sister clade to two species of the genus Aglenchus.

YOUSEF PANAHANDEH, EBRAHIM POURJAM, MAJID PEDRAM

Journal of Nematology, Volume 48 , ISSUE 4, 268–279

Research Article | 03-December-2018

Description of Gracilacus paralatescens n. sp. (Nematoda:Paratylenchinae) found from the rhizosphere of Bamboo in Zhejiang, China

slender, slightly curved and 17.5 to 18.9 µm long. In the phylogenetic analysis based on 18S, D2-D3 of 28S and ITS regions of rDNA, the new species is clustered with Paratylenchid species having longer stylet length. Morphologically, the new species belongs to Group 9 of Paratylenchus sensu lato and is most similar to G. latescens.

Munawar Maria, Ruihang Cai, Weimin Ye, Thomas O. Powers, Jingwu Zheng

Journal of Nematology, Volume 50 , ISSUE 4, 611–622

Original Paper | 10-December-2018

Aspergillus penicillioides Speg. Implicated in Keratomycosis

of the following rDNA regions: ITS1, ITS2, 5.8S, 28S rDNA, LSU and β-tubulin were carried out for the isolates studied. A high level of similarity was found between sequences from certain rDNA regions, i.e. ITS1-5.8S-ITS2 and LSU, what confirmed the classification of the isolates to the species A. penicillioides. The classification of our isolates to A. penicillioides species was confirmed also by the phylogenetic analysis.

EULALIA MACHOWICZ-MATEJKO, AGNIESZKA FURMAŃCZYK, EWA DOROTA ZALEWSKA

Polish Journal of Microbiology, Volume 67 , ISSUE 4, 407–416

research-article | 03-June-2019

Morphological and molecular characterization of Labronema montanum sp. n. (Dorylaimida, Dorylaimidae) from Spain

final volume of 25 μl. The primers used for amplification of the D2-D3 region of 28S rRNA gene were the D2A (5′-ACAAGTACCGTGAGGGAAAGTTG-3′) and the D3B (5′-TCGGAAGGAACCAGCTACTA-3′) primers (De Ley et al., 1999). PCR cycle conditions were as follows: one cycle of 94°C for 3 min, followed by 35 cycles of 94°C for 1 min + annealing temperature of 55°C for 45 s + 72°C for 2 min, and finally one cycle of 72°C for 10 min. After DNA amplification, 5 μl of product was loaded on a 1% agarose gel in 0.5% Tris

R. Peña-Santiago, J. Abolafia

Journal of Nematology, Volume 51 , 1–11

research-article | 30-November-2019

Characterization of a population of Pelodera strongyloides (Nematoda: Rhabditidae) associated with the beetle Lucanus ibericus (Coleoptera: Lucanidae) from Georgia

. In the present study, a Georgian population of P. strongyloides recovered for the first time from L. ibericus and was fully characterized by morphology and morphometrics. Furthermore, the PCR amplification and sequencing of the D2 to D3 expansion domains of the 28S rRNA gene, the ITS, and the mitochondrial COI were carried out. The phylogenetic relationships of P. strongyloides from Georgia to other Pelodera species and Rhabditidae were also reconstructed. Materials and methods Nematode

O. Gorgadze, A. Troccoli, E. Fanelli, E. Tarasco, F. De Luca

Journal of Nematology, Volume 52 , 1–12

research-article | 06-November-2020

Morphological and molecular characterization of Epidorylaimus procerus sp. n. (Dorylaimida: Qudsianematidae) from Vietnam

solution. The PCR amplification profile consisted of 4 min at 94°C, 35 cycles of 1 min at 94°C, 1.5 min at 55°C, and 2 min at 72°C, followed by a final step of 10 min at 72°C. The primers used for amplification were D2A (5´-ACAAGTACCGTGAGGGAAAGTTA-3´) and D3B (5´-TCCTCGGAAGGAACCAGCTACTA-3´) for amplification of the D2-D3 region of 28S (Subbotin et al., 2006). PCR products were purified with the GeneJET PCR Purification Kit (#K0701, Thermo Scientific, USA), following the manufacturer’s manual. The

Thi Anh Duong Nguyen, Reyes Peña-Santiago

Journal of Nematology, Volume 52 , 1–8

Article | 03-December-2017

Taxonomy and Systematics of the Genus Makatinus Heyns, 1965 (Nematoda: Dorylaimida: Aporcelaimidae)

The taxonomy and the systematics of the genus Makatinus are discussed by means of the characterization of its morphological pattern and the first molecular (D2–D3 expansion segments of 28S rDNA) analysis of a representative of this taxon, Makatinus crassiformis from Costa Rica. The presence of two or more pairs of male ad-cloacal genital papillae is the most characteristic autapomorphy of the genus, but the status of its species on this concern differ among them. Both morphological and

REYES PENA-SANTIAGO, INGRID VARELA

Journal of Nematology, Volume 49 , ISSUE 3, 245–253

Research Article | 03-September-2018

Nothotylenchus andrassy n. sp. (Nematoda: Anguinidae) from Northern Iran

anus distance); and elongate, conical tail with pointed tip. Nothotylenchus andrassy n. sp. is morphologically similar to five known species of the genus, namely Nothotylenchus geraerti, Nothotylenchus medians, Nothotylenchus affinis, Nothotylenchus buckleyi, and Nothotylenchus persicus. The results of molecular analysis of rRNA gene sequences, including the D2–D3 expansion region of 28S rRNA, internal transcribed spacer (ITS) rRNA and partial 18S rRNA gene are provide for the new species.

Parisa Jalalinasab, Mohsen Nassaj Hosseini, Ramin Heydari

Journal of Nematology, Volume 50 , ISSUE 2, 219–228

research-article | 30-November-2019

An integrative approach to the study of Helicotylenchus (Nematoda: Hoplolaimidae) Colombian and Brazilian populations associated with Musa crops

% Triton x–100, 4.5% Tween–20, 0.09% Proteinase K). The tubes were incubated at −80°C (15 min), 65°C (1 h), and 95°C (15 min), centrifuged to 16,000 g (1 min) and stored at −20°C. Amplification of D2 to D3 expansion segment of the large subunit – LSU of ribosomal DNA (28S) was done using forward primer D2A (5′–ACAAGTACCGTGAGGGAAAGTTG–3′) and reverse D3B (5′–TCCTCGGAAGGAACCAGCTACTA–3′) (De Ley et al., 1999). The PCR conditions were initial denaturation during 2 min at 94°C followed by 40 cycles of 45 s

Donald Riascos-Ortiz, Ana Teresa Mosquera-Espinosa, Francia Varón De Agudelo, Claudio Marcelo Gonçalves de Oliveira, Jaime Eduardo Muñoz-Florez

Journal of Nematology, Volume 52 , 1–19

research-article | 30-November-2020

Integrative taxonomy, distribution, and host associations of Geocenamus brevidens and Quinisulcius capitatus from southern Alberta, Canada

). Three sets of DNA primers (Integrated DNA Technologies, Coralville, IA, USA) were used in the PCR analyses to amplify nucleotide sequences of the partial 18S, 28S (LSU), and ITS of ribosomal RNA genes (rDNA). The partial 18S region was amplified with 1813F and 2646R primers (Holterman et al., 2006). The LSU rDNA regions were amplified using 28–81for and 28–1006rev primers (Holterman et al., 2008), and the ITS was amplified with the F194 (Ferris et al., 1993) and AB28-R primers (Curran et al., 1994

Maria Munawar, Dmytro P. Yevtushenko, Pablo Castillo

Journal of Nematology, Volume 53 , 1–17

research-article | 30-November-2020

First report of root-lesion nematode, Pratylenchus oleae from pistachio in Iran

carried out in a 30  μl reaction comprising of 2  µL DNA template, 1  μl forward and reverse primers, 15  μl Taq DNA Polymerase 2 × Master Mix (Ampliqon), and 11  μl distilled water. The forward primer D2A (5′-ACAAGTACCGTGA GGGAAAGTTG-3′) and the reverse primer D3B (5′-TCGGAAGGAACCAGCTACTA-3′) (Subbotin et al., 2006) were used for amplification of the D2–D3 expansion region of the 28S rRNA gene. The PCR amplification profile consisted of 4 min at 95°C; 33 cycles of 30 sec at 95°C, 40 sec at 53°C and

Farhad Saeidi Naeini, Zahra Majd Taheri

Journal of Nematology, Volume 53 , 1–7

Article | 21-July-2017

Occurrence of Panagrellus (Rhabditida: Panagrolaimidae) Nematodes in a Morphologically Aberrant Adult Specimen of Rhynchophorus ferrugineus (Coleoptera: Dryophthoridae)

An aberrant specimen of Rhynchophorus ferrugineus (Coleoptera: Dryophthoridae) also known as red palm weevil (RPW), the most economically important insect pest of palms in the world, was found among a batch of conspecifics reared for research purposes. A morphological analysis of this weevil revealed the presence of nematodes associated with a structured cuticle defect of the thorax. These nematodes were not able to be cultured, but were characterized by molecular analysis using 28S

MANUELA CAMEROTA, GIUSEPPE MAZZA, LYNN K. CARTA, FRANCESCO PAOLI, GIULIA TORRINI, CLAUDIA BENVENUTI, BEATRICE CARLETTI, VALERIA FRANCARDI, PIO FEDERICO ROVERSI

Journal of Nematology, Volume 48 , ISSUE 1, 1–6

Article | 21-July-2017

Morphological and Molecular Characterization of Gracilacus wuae n. sp. (Nematoda: Criconematoidea) Associated with Cow Parsnip (Heracleum maximum) in Ontario, Canada

-stage juveniles lack a stylet, the pharynx degenerated, and can be differentiated into preadult females and males based on the position of the genital primordia. The third-stage juveniles are similar to females but smaller. Phylogenetic studies using the rDNA small subunit 18S, large subunit 28S D2/D3, and internal transcribed spacer (ITS) sequences collectively provide evidence of a grouping with other Gracilacus and some species of Paratylenchus with stylet length of females longer than 41 mm

QING YU, WEIMIN YE, TOM POWERS

Journal of Nematology, Volume 48 , ISSUE 3, 203–213

Original Research | 18-July-2017

Deladenus posteroporus n. sp. (Nematoda: Neotylenchidae) Isolated from Packaging Wood from Canada and White Pine (Pinus monticola) Lumber from the United States and Intercepted in Ningbo, China

infective forms, by a broadly rounded tail end in mycetophagous females and lateral fields with 11 to 12 lines midbody in both mycetophagous females and males. The partial 18S, complete internal transcribed spacer, and partial 28S D2/D3 rRNA genes were amplified and sequenced. Phylogenetic analyses of the genes grouped the new species with previously sequenced species of Deladenus in a fully supported clade. This is the first report of Deladenus species with a known infective stage to have the excretory

Qing Yu, Jianfeng Gu, Weimin Ye, Rusong Li, Jie He

Journal of Nematology, Volume 49 , ISSUE 2, 168–176

Research Article | 17-October-2018

Characterization of Meloidogyne indica (Nematoda: Meloidogynidae) Parasitizing Neem in India, with a Molecular Phylogeny of the Species

juveniles, males and females were carried out by light compound and scanning electron microscopy. Gross morphology and measurements were found consistent with the original description of M. indica infecting citrus by Whitehead (1968). The neem population was found to infect and reproduce on citrus. Additionally, evolutionary relationship was deduced by Maximum likelihood method using ITS rRNA, D2D3 expansion segment of 28S rRNA and mitochondrial COI sequences. Phylogenetic analyses based on these

Victor Phani, Satyapal Bishnoi, Amita Sharma, Keith G. Davies, Uma Rao

Journal of Nematology, Volume 50 , ISSUE 3, 387–398

Research Article | 03-December-2018

First report of Pratylenchus vulnus associated with apple in Tunisia

. Microscopic observation of females and males demonstrated the occurrence of Pratylenchusd vulnus on apple trees. The ribosomal DNA D2-D3 expansion segments of the 28S rRNA and of the Pratylenchus populations were PCR amplified and sequenced. The sequences were compared with those of Pratylenchus species in the GenBank database with high similarity (99%). This comparison reconfirmed the morphological identifications. Phylogenetic studies placed those populations with P. vulnus. This is the first report of

Noura Chihani-Hammas, Lobna Hajji-Hedfi, Hajer Regaieg, Asma Larayedh, Ahmed Badiss, Yu Qing, Horrigue-Raouani Najet

Journal of Nematology, Volume 50 , ISSUE 4, 579–586

research-article | 30-November-2018

First report of Mesocriconema xenoplax (Nematoda: Criconematidae) from turfgrass in Portugal and in Europe

, DNA from selected female specimens was used for sequencing of the D2/D3 expansion segments of the 28S ribosomal RNA, following Subbotin et al. (2005). In total, 10 nematodes (juveniles and females) were handpicked and transferred individually to Eppendorf tubes with 10 µl of sterilized water, for DNA extraction, PCR amplification, and sequencing. Each nematode was frozen in liquid nitrogen and homogenized with a micro-pestle (Eppendorf, Hamburg, Germany). The homogenate was incubated at 56°C in

M. L. Inácio, L. C. Rusinque, M. J. Camacho, F. Nóbrega

Journal of Nematology, Volume 51 , 1–6

research-article | 30-November-2019

First report of the stubby-root nematode Nanidorus minor infecting Paspalum vaginatum, seashore paspalum grass in Georgia, USA

, the mixture was incubated at room temperature (23 ± 2°C) for 10 min and then at 95°C for 3 min. Finally, 20 µL of neutralization solution was added to the tube and vortexed briefly. This DNA extract was stored at −20°C and used as DNA template for PCR reactions in 2 µL aliquots. Three primer pairs targeting 18S rDNA (360F/932R), 28S rDNA (D2A/D3B) and ITS1 rDNA (BL18/5818) (Riga et al., 2007; Duarte et al., 2010; Ye et al., 2015) were used in singleplex PCR (Hajihassani et al., 2018a). The

Ganpati B. Jagdale, Fereidoun Forghani, Katherine Martin, Abolfazl Hajihassani, Alfredo Dick Martinez-Espinoza

Journal of Nematology, Volume 52 , 1–3

research-article | 24-November-2020

Description of Heterodera microulae sp. n. (Nematoda: Heteroderinae) from China – a new cyst nematode in the Goettingiana group

diagnosis is gaining more reliability for precise and accurate identification of cyst-forming nematodes (Peng et al., 2003). The internal transcribed spacer region of the ribosomal DNA (ITS-rDNA), the D2 and D3 expansion fragments of the 28S ribosomal DNA genes (D2-D3 of 28S-rDNA), and mitochondrial DNA (COI gene) units are good candidate genes for molecular taxonomic and phylogenetic studies (Subbotin et al., 2001; Subbotin et al., 2006; Madani et al., 2004; Vovlas et al., 2017). Based on

Wenhao Li, Huixia Li, Chunhui Ni, Deliang Peng, Yonggang Liu, Ning Luo, Xuefen Xu

Journal of Nematology, Volume 52 , 1–16

research-article | 11-January-2018

Morphological and Molecular Characterization of Paralongidorus sali Siddiqi, Hooper, and Khan, 1963 with a Description of the First-Stage Juvenile and Male of Longidorus jonesi Siddiqi, 1962 from China

study were to: (i) provide updated morphological descriptions of first-stage juvenile P. sali, and male of L. jonesi, (ii) characterize the molecular data of both species using the D2–D3 expansion segments of 28S rRNA and partial 18S rRNA gene sequences, and (iii) demonstrate the phylogenetic relationships of both species with related species. Materials and Methods Nematode sampling, extraction and morphological study Nematodes were extracted from soil samples using modified Baermann funnel method

Ruihang Cai, Munawar Maria, Nan Qu, Pablo Castillo, Jingwu Zheng

Journal of Nematology, Volume 50 , ISSUE 3, 419–436

research-article | 30-November-2020

First report of Seville root-knot nematode, Meloidogyne hispanica (Nematoda: Meloidogynidae) in the USA and North America

PCR reaction. Six J2 were examined for each marker. DNA markers were amplified using the following primers: the internal transcribed spacer region (ITS1-5.8S-ITS2) of rRNA gene was amplified with primers TW81 [5′-GTTTCCGTAGGTGAACCTGC-3′] and AB28 [5′-ATATGCTTAAGTTCAGCGGGT-3′] as described by Skantar et al. (2012); the D2–D3 expansion segments of the large subunit (LSU) 28S rRNA gene were amplified with primers D2A [5′- ACAAGTACCGTGAGGGAAAGTT-3′] and D3B [5′-TCGGAAGGAACCAGCTACTA-3′] according to De

Andrea M. Skantar, Zafar A. Handoo, Sergei A. Subbotin, Mihail R. Kantor, Paulo Vieira, Paula Agudelo, Maria N. Hult, Stephen Rogers

Journal of Nematology, Volume 53 , 1–7

Article | 21-July-2017

Steinernema biddulphi n. sp., a New Entomopathogenic Nematode (Nematoda: Steinernematidae) from South Africa

-pharynx (D% = 46). Hyaline layer occupies approximately half of tail length. Male spicules slightly to moderately curved, with a sharp tip and golden brown in color. The first generation of males lacking a mucron on the tail tip while the second generation males with a short filamentous mucron. Genital papillae with 11 pairs and one unpaired preanal papilla. The new species is further characterized by sequences of the internal transcribed spacer (ITS) and partial 28S regions (D2-D3) of the ribosomal

HARUN CIMEN, VLADIMI´R PU°zA, JIRI NERMUT, JUSTIN HATTING, TSHIMA RAMAKUWELA, SELCUK HAZIR

Journal of Nematology, Volume 48 , ISSUE 3, 148–158

Article | 21-July-2017

Description of Aphelenchoides macrospica n. sp. (Nematoda:Aphelenchoididae) from Northwestern Iran

based on sequences of D2-D3 expansion region of 28S and 18S rDNA, confirmed its status as a new species.

BEHROUZ GOLHASAN, RAMIN HEYDARI, MEHRAB ESMAEILI, ESMAEIL MIRAEIZ

Journal of Nematology, Volume 49 , ISSUE 1, 67–76

Article | 04-December-2017

A New Species of the Rare Genus Anguillonema Fuchs, 1938 (Nematoda: Hexatylina, Sphaerularioidea) with Its Molecular Phylogenetic Study

monodelphic-prodelphic reproductive system, 15 to 19 mm long conical tail with broad rounded tip, and males absent. The new species is compared with two known species of the genus, Anguillonema poligraphi and A. crenati. Molecular phylogenetic studies of the new species using partial sequences of small subunit (SSU) rDNA revealed that it forms a clade with an unidentified nematode species and two species of the genus Howardula. In phylogenetic analyses using partial sequences of the 28S rDNA (D2-D3

MAHYAR MOBASSERI, MAJID PEDRAM, EBRAHIM POURJAM

Journal of Nematology, Volume 49 , ISSUE 3, 286–294

Research Article | 31-May-2018

Delatylus andersoni n. gen., n. sp. (Nematoda: Neotylenchidae) Isolated from White Pine (Pinus monticola) Lumber from USA and Intercepted in Ningbo, China

Three populations of neotylenchid nematodes were isolated in Ningbo, P. R. China, from white pine lumber (Pinus monticola) imported from the USA. The nematodes were morphologically intermediate between Hexatylus and Deladenus. The nematodes were molecularly characterized based on sequences of the rDNA small subunit 18S, large subunit 28S D2/D3, and internal transcribed spacer sequences. The phylogenetic inferences placed the nematodes with other neotylenchid nematodes, i.e., Fergusobia and

Qing Yu, Maria Munawar, Jianfeng Gu, Weimin Ye

Journal of Nematology, Volume 50 , ISSUE 1, 69–76

Research Article | 17-October-2018

Description of Xiphinema parachambersi sp. n. (Nematoda: Longidoridae) from Imported Ornamental Plants in Japan with a Key to Xiphinema Species in Group 1

rounded terminus. Only two juvenile stages were available to study and no male was found. The polytomous identification codes for this new species are A1, B4, C2, D23, E1, F2, G2, H2, I2, J2, K?, L1 and it belongs to the morphospecies group 1. Phylogenetic analysis based on the 18S, ITS1 and 28S D2/D3 sequences of the new species showed close relationships with X. chambersi. Morphologically, the new species is similar to X. chambersi, X. hangzhouense, and X. winotoi but can be differentiated by

Munawar Maria, Weimin Ye, Qing Yu, Jianfeng Gu

Journal of Nematology, Volume 50 , ISSUE 3, 369–386

Research Article | 03-December-2018

First report of Bursaphelenchus antoniae from Pinus strobus in the U.S.

only 95% similarity with PWN B. xylophilus. Compared to the previously described Portuguese population of B. antoniae, the sequences generated for the MA population were 98.3% similar in the ITS1, 2 rDNA and 99.9% similar for 28S rDNA. There was 99.2% similarity between the COI sequences of the US and Portuguese isolates of B. antoniae. This population has morphology consistent with that of Penas et al., 2006; however, the female tail on this MA pine population is mucronate and more attenuated than

Lynn K. Carta, R. L. Wick

Journal of Nematology, Volume 50 , ISSUE 4, 473–478

research-article | 28-April-2020

Morphological and molecular characterization of Pungentus sufiyanensis n. sp. and additional data on P. engadinensis (Altherr, 1950) Altherr, 1952 (Dorylaimida: Nordiidae) from northwest of Iran

transferred to an Eppendorf tube containing 25.65 μl ddH2O, 2.85 μl 10 × PCR buffer and 1.5 μl proteinase K (600 μg/ml) (Promega, Benelux, the Netherlands). The tubes were incubated at −80°C (1 h), 65°C (1 h) and 95°C (15 min). The extracted DNA was stored at −20°C until use. The D2-D3 domains of the 28S rDNA were amplified with forward primer D2A (5´-ACAAGTACCGTGAGGGAAAGTTG-3´) and reverse primer D3B (5´-TCGGAAGGAACCAGCTACTA-3´) (Nunn, 1992). In total, 25 μl PCR reaction mixture was prepared constituting

Nasir Vazifeh, Gholamreza Niknam, Habibeh Jabbari, Reyes Peña-Santiago

Journal of Nematology, Volume 52 , 1–12

research-article | 30-November-2020

A new cyst-forming nematode, Cactodera tianzhuensis n. sp. (Nematoda:Heteroderinae) from Polygonum viviparum in China with a key to the Genus Cactodera

length of stylet, tail and hyaline tail in second-stage juvenile, and the surface differentiation in eggs (Subbotin et al., 2010). However, traditional identification of cyst forming nematode based on morphology is imprecise and time-consuming to separate the related species. During the past 30 years, molecular data, including ITS-rDNA, D2-D3 region of 28S-rDNA, are more accurate tool for identification of cyst-forming nematode species. Sequence analysis of the ITS-rDNA and the D2-D3 region of 28S

Wenhao Li, Huixia Li, Chunhui Ni, Mingming Shi, Xuejuan Wei, Yonggang Liu, Yiwen Zhang, Deliang Peng

Journal of Nematology, Volume 53 , 1–15

research-article | 30-November-2020

Report of the Texas peanut root-knot nematode, Meloidogyne haplanaria (Tylenchida: Meloidogynidae) from American pitcher plants (Sarracenia sp.) in California

Olympus BX51 microscope equipped with Nomarski interference contrast. Molecular analysis of nematode samples DNA was extracted from several J2 specimens using the proteinase K protocol. DNA extraction and PCR protocols were as described by Janssen et al. (2016) and Subbotin (2021a). The following primer sets were used in this study: D2A (5′-ACA AGT ACC GTG AGG GAA AGT TG-3′) and D3B (5′-TCG GAA GGA ACC AGC TAC TA-3′) amplifying the D2-D3 expansion segments of 28S rRNA gene, TW81 (5′-GTT TCC GTA GGT

Sergei A. Subbotin

Journal of Nematology, Volume 53 , 1–7

research-article | 26-April-2019

First report of Meloidogyne javanica on Ginger and Turmeric in the United States

Abolfazl Hajihassani, Weimin Ye, Brooke B. Hampton

Journal of Nematology, Volume 51 , 1–3

Research Article | 26-September-2018

Occurrence of Sheraphelenchus sucus (Nematoda: Aphelenchoidinae) and Panagrellus sp. (Rhabditida: Panagrolaimidae) Associated with Decaying Pomegranate Fruit in Italy

rRNA gene, D2–D3 expansion domains of the 28S rDNA, the ITS region, and the partial mitochondrial COI were carried out. Sequences of the 18S rRNA gene, the D2–D3 domains, and the ITS were analyzed using several methods for inferring phylogeny to reconstruct the relationships among Sheraphelenchus and Bursaphelenchus species. The bacterial feeder Panagrellus sp. was characterized at the molecular level only. The D2–D3 expansion domains and ITS sequences of this Italian panagrolaimid were determined

ELENA FANELLI, ALBERTO TROCCOLI, NICOLA VOVLAS, GIANLUCA SCARCIA, ANNAMARIA MINCUZZI, SIMONA M. SANZANI, ANTONIO IPPOLITO, FRANCESCA DE LUCA

Journal of Nematology, Volume 49 , ISSUE 4, 418–426

research-article | 30-November-2019

Description of Deladenus gilanica n. sp. (Hexatylina: Neotylenchidae) isolated from wood of black pine in Northern Iran

partial 18S and 28S D2 to D3 rRNA gene sequences, and (ii) to investigate the phylogenetic relationships of this neotylenchid nematode within the superfamily Sphaerularioidea. Materials and methods Sampling, extraction, mounting, and drawing Soil, root, and wood samples were randomly collected from different regions of eastern forests in Guilan Province, Northern Iran during 2015. Nematodes were recovered directly from the wood samples by the Whitehead tray method (Whitehead and Hemming, 1965). The

Parisa Jalalinasab, Mehrab Esmaeili, Weimin Ye, Ramin Heydari

Journal of Nematology, Volume 52 , 1–10

research-article | 30-November-2019

Aphelenchus yinyuensis n. sp. (Tylenchina: Aphelenchoididae) found in Terminalia sp. in China

sequences of the near full-length 18S region, D2-D3 expansion segments of 28S, and ITS of ribosomal RNA genes (rDNA). The 18S region was amplified with primers 988F/1912R and 1813F/2646R (Holterman et al., 2006). The 28S D2 to D3 region was amplified with primers D2A/D3B (De Ley et al., 1999), and the ITS was amplified using primers TW81/AB28 (Tanha Maafi et al., 2003). PCR conditions were as described by Ye et al. (2007) and Li et al. (2008). PCR products were separated on 1% agarose gels and

Gu Jianfeng, Munawar Maria, Yiwu Fang, Liu Lele, Xianfeng Chen, Bo Cai

Journal of Nematology, Volume 52 , 1–12

research-article | 30-November-2020

Morphological and molecular characterization of Iotonchus lotilabiatus n. sp. (Nematoda: Iotonchidae) from Lao Cai Province, Vietnam

illustrations were edited by using Adobe Photoshop CC 2018. DNA extraction, polymerase chain reaction (PCR), and sequencing Nematode DNA was extracted from a single individual as described by Holterman et al. (2006) and DNA extracts were stored at –20° until used as PCR template. The D2-D3 expansion segment 28S rDNA and 18S were amplified using the forward D2A (5′–ACAAGTACCGTGGGGAAAGTTG–3′) and reverse D3B (5′–TCGG AAGGAACCAGCTACTA–3′) primers (Subbotin et al., 2006) and primers 18S (18F : 5

Tam T. T. Vu, Thi Mai Linh Le, Thi Duyen Nguyen

Journal of Nematology, Volume 53 , 1–22

research-article | 30-November-2020

Characterization of Pterotylenchus cecidogenus in Desmodium ovalifolium cover crop from oil palm plantations in central Colombia

mM Tris pH 8.0, 15 mM MgCl2, 0.5% Triton × 100, 4.5% Tween 20, and 0.09% Proteinase K). Subsequently, the tubes were incubated at ‒80°C for 15 min, 65 °C for 1 h, and 95°C for 15 min, centrifuged at 16,000 × g for 1 min, and stored at ‒20°C. The polymerase chain reaction (PCR) amplification of the expansion segment D2-D3 of the large subunit of ribosomal DNA (28S) was performed with the primers D2A (5′-ACAAGTACCGTGAGGGAAAGTTG-3′) forward and D3B (5′-TCCTCGGAAGGAACCAGCTACTA-3′) reverse, according

Oscar Velandia, Yuri Mestizo, Héctor Camilo Medina, Donald Riascos-Ortiz, Francia Varón De Agudelo, Greicy Andrea Sarria

Journal of Nematology, Volume 53 , 1–14

research-article | 17-March-2020

Characterization of root-knot nematodes infecting mulberry in Southern China

the following program: initial denaturation at 94°C for 4 min; 35 cycles of denaturation at 94 °C for 1 min, annealing at 55 °C for 1 min, and elongation at 72 °C for 2 min; followed by a final extension at 72 °C for 10 min. The D2-D3 region of the 28S gene was amplified with primer D2A (5′-ACAAGTACCGTGAGGAAAGTTG-3′) and D3B (5′-TCGGAAGGAACCAGCTACTA-3′) described by Sturhan et al. (2006). PCR reaction conditions were the same as those described for the ITS region. Sequence and phylogenetic

Pan Zhang, Hudie Shao, Chunping You, Yan Feng, Zhenwen Xie

Journal of Nematology, Volume 52 , 1–8

research-article | 30-November-2019

Molecular and morphological characterization of the amaryllis lesion nematode, Pratylenchus hippeastri (Inserra et al., 2007), from California

Zafar A. Handoo, Andrea M. Skantar, Mihail R. Kantor, Saad L. Hafez, Maria N. Hult

Journal of Nematology, Volume 52 , 1–5

research-article | 30-November-2020

Molecular and morphological characterization of a first report of Cactodera torreyanae Cid del Prado Vera & Subbotin, 2014 (Nematoda: Heteroderidae) from Minnesota, the United States of America

, amplification, purification of PCR products, cloning, and sequencing were performed as described in Skantar et al. (2012) and Subbotin (2021a). The following primer sets were used for PCR: the forward D2A (5′ – ACA AGT ACC GTG AGG GAA AGT TG – 3′) and the reverse D3B (5′ – TCG GAA GGA ACC AGC TAC TA – 3′) primers for amplification of the D2-D3 expansion segments of 28S rRNA gene; the forward TW81 (5′ – GTT TCC GTA GGT GAA CCT GC – 3′) and the reverse AB28 (5′ – ATA TGC TTA AGTT CAG CGG GT – 3′) primers for

Zafar A. Handoo, Andrea M. Skantar, Sergei A. Subbotin, Mihail R. Kantor, Maria N. Hult, Michelle Grabowski

Journal of Nematology, Volume 53 , 1–5

No Record Found..
Page Actions