Search

  • Select Article Type
  • Abstract Supplements
  • Blood Group Review
  • Call to Arms
  • Hypothesis
  • In Memoriam
  • Interview
  • Introduction
  • Short Report
  • abstract
  • Abstracts
  • Article
  • book-review
  • case-report
  • case-study
  • Clinical Practice
  • Commentary
  • Conference Presentation
  • conference-report
  • congress-report
  • Correction
  • Editorial
  • Editorial Comment
  • Erratum
  • Events
  • Letter
  • Letter to Editor
  • mini-review
  • minireview
  • News
  • non-scientific
  • Obituary
  • original-paper
  • Original Research
  • Pictorial Review
  • Position Paper
  • Practice Report
  • Preface
  • Preliminary report
  • Product Review
  • rapid-communication
  • Report
  • research-article
  • Research Communicate
  • research-paper
  • Research Report
  • Review
  • review -article
  • review-article
  • Review Paper
  • Sampling Methods
  • Scientific Commentary
  • short-communication
  • short-report
  • Student Essay
  • Varia
  • Welome
  • Select Journal
  • Polish Journal Of Microbiology
  • Journal Of Nematology

 

research-article

Phylogenetic studies on three Helicotylenchus species based on 28S rDNA and mtCOI sequence data

process as well as to delineate more phylogenetically distant species, which share the same morphology (cryptic species), the support of a molecular approach is needed. To date, only about 20% of Helicotylenchus species has been molecularly characterized using mostly ribosomal DNA fragments (18S, ITS, 28S rDNA; GenBank resources). Mitochondrial cytochrome c oxidase subunit I (mtCOI) sequences were reported for one species, the recently described H. oleae (Palomares-Rius et al., 2018), and a cytochrome

K. Rybarczyk-Mydłowska, E. Dmowska, K. Kowalewska

Journal of Nematology , 1–17

research-article

First report of Paratylenchus lepidus Raski, 1975 associated with green tea (Camellia sinensis (L.) Kuntze) in Vietnam

, measurements and pictures were taken using Carl Zeiss Axio Lab. A1 light microscope equipped with a Zeiss Axiocam ERc5s digital camera. For molecular characterization, the D2-D3 region of 28S rDNA and COI mtDNA gene were amplified using D2A/D3B (5′–ACAAGTACCGTGGGGAAAGTTG–3′/5′–TCGGAAGGAACCAGCTACTA–3′) (Subbotin et al., 2006) and JB3/JB4 (5′-TTTTTTGGGCATCCTGAGGTTTAT-3′/5′-TAAAGAAAGAACATAATGAAAATG-3′) (Nguyen et al., 2019b) primers. Forward and reverse sequences were assembled using Geneious R11

Thi Mai Linh Le, Huu Tien Nguyen, Thi Duyen Nguyen, Quang Phap Trinh

Journal of Nematology , 1–4

research-article

First report of Xiphinema hunaniense Wang & Wu, 1992 (Nematoda: Longidoridae) in Vietnam

. A1 light microscope equipped with a Zeiss Axiocam ERc5s digital camera. For molecular characterization, the 5′-end region of 28S rDNA was amplified using DP391/501 primers (5′-AGCGGAGGAAAAGAAACTAA-3′/5′-TCGGAAGGAACCAGCTACTA-3′) following Nguyen et al. (2019b). Forward and reverse sequences were assembled and analyzed using Geneious R11 (Nguyen et al., 2019b, 2019c). The best fit model was chosen using Mega 7 following Nguyen et al. (2019b). Results and discussion Measurements Eight females: L

Huu Tien Nguyen, Thi Duyen Nguyen, Thi Mai Linh Le, Quang Phap Trinh

Journal of Nematology , 1–4

Article

Description of Enchodorus yeatsi n. sp. (Dorylaimida, Nordiidae) from Southern Iran and Its Molecular Phylogenetic Study

sequences of 28S rDNA D2/D3 and internal transcribed spacer 1 (ITS1) fragments. Compared to Enchodorus neodolichurus, it has basic differences in tail characters and spicule lengths. Molecular phylogenetic studies using partial sequences of 28S rDNA D2/D3 fragment of the new species and available sequences of Nordiidae members and several other dorylaim species/genera, revealed E. yeatsi n. sp. and E. dolichurus forming a clade with 0.81 Bayesian posterior probability (BPP). This

MAJID PEDRAM

Journal of Nematology , ISSUE 1, 21–26

Research Article

Morphological and Molecular Characterization of Labrys filiformis n. sp. (Rhabditida: Tylenchidae) from Iran

duct, offset spermatheca filled with small spheroid sperm cells, 106 to 127 µm long elongate-conoid tail with filiform distal region and finely rounded tip. Molecular phylogenetic analyses were performed using a near-full length fragment of the 18S rDNA and the D2–D3 expansion segments of the 28S rDNA using Bayesian inference and maximum likelihood methods. In the inferred phylogenetic tree with 18S rDNA, the new species has a close affinity with several isolates of the type species, Labrys

Yousef Panahandeh, Joaquín Abolafia, Ebrahim Pourjam, Robin M. Giblin-Davis, Farahnaz Jahanshahi Afshar, Majid Pedram

Journal of Nematology , ISSUE 3, 343–354

Research Article

Molecular Characterization and Phylogeny of Ditylenchus weischeri from Cirsium arvense in the Prairie Provinces of Canada

molecular analysis of many D. weischeri specimens from Canada is presented. Individuals from 41C. arvense or yellow pea grain samples with seeds of C. arvense from the Prairie Provinces were sequenced for the internal transcribed spacer (ITS rDNA), large subunit (LSU) D2D3 28S rDNA, partial segment of small subunit (SSU) 18S rDNA, and the heat shock protein Hsp90 gene. The analysis also included D. weischeri individuals from C. arvense from Russia and garlic with D. dipsaci from the Provinces of Ontario

Mehrdad Madani, Mario Tenuta

Journal of Nematology , ISSUE 2, 163–182

research-article

On the identity of Eucephalobus oxyuroides (de Man, 1876) Steiner, 1936 (Rhabditida, Cephalobidae), with an updated taxonomy of the genus and notes about its phylogeny

microscopy (SEM) Specimens preserved in glycerine were selected for observation under SEM according to the methods of Abolafia (2015). They were hydrated in distilled water, dehydrated in a graded ethanol-acetone series, critical point dried, coated with gold, and observed with a Zeiss Merlin microscope (5 kV) (Zeiss, Oberkochen, Germany). Phylogenetic analyses For phylogenetic relationships, analyses were based on 18S and 28S rDNA gene sequences available in GenBank. The sequences were aligned using

Joaquín Abolafia, Reyes Peña-Santiago

Journal of Nematology , 1–20

research-article

Morphological and Molecular Characterization of Oscheius saproxylicus sp. n. (Rhabditida, Rhabditidae) From Decaying Wood in Spain, With New Insights into the Phylogeny of the Genus and a Revision of its Taxonomy

Applied Biosystems Hitachi 3500 Genetic Analyzer. The sequences obtained were submitted to the GenBank database. Phylogenetic analyses For phylogenetic relationships, analyses were based on 18S and 28S rDNA. The newly obtained sequences were manually edited using BioEdit 7.2.6 (Hall, 1999) and aligned with another 18S or 28S rRNA gene sequences available in GenBank using Muscle alignment tool implemented in the MEGA7 (Kumar et al., 2016). The ambiguously aligned parts and divergent regions were

Joaquín Abolafia, Reyes Peña-Santiago

journal of nematology , 1–21

Research Article

Description of Longidorus azarbaijanensis n. sp. (Dorylaimida: Longidoridae) from Iran

. sturhani. The morphological differences of the new species with the aforementioned species are discussed. For all the aforementioned species (except L. protae, currently lacking molecular data) the differences of the new species was also confirmed with differences in molecular sequences of D2-D3 expansion domains of 28S rDNA and the corresponding phylogenetic analyses. The partial sequence of the internal transcribed spacer 1 (ITS1) of the new species was also used in phylogenetic analyses. In partial

Farshad Gharibzadeh, Ebrahim Pourjam, Majid Pedram

Journal of Nematology , ISSUE 2, 207–218

research-article

Description of a new dagger nematode, Xiphinema barooghii n. sp. (Nematoda: Longidoridae) and additional data on the three known species of the genus from northwest of Iran

phylogenetic tree (Fig. 5). Phylogenetic analyses The newly obtained sequences were aligned using MEGA6 (Tamura et al., 2013) and compared with other Xiphinema D2–D3 expansion segment of 28S rDNA gene sequences available in GenBank using the Nblast homology search program. Longidorus helveticus (Lamberti et al., 2001) (AY601566) was chosen as out group. The best-fitted model of DNA evolution was obtained using MrModeltest 2.3 (Nylander, 2004) with the Akaike Information Criterion (AIC). Phylogenetic

Nasir Vazifeh, Gholamreza Niknam, Habibeh Jabbari, Arezoo Naghavi

Journal of Nematology , 1–17

research-article

First report of Mesocriconema sphaerocephalum (Taylor, 1936) Loof, 1989 associated with carrot (Daucus carota subsp. Stativus) in Vietnam

Zeiss Axio Lab.A1 light microscope. Measurements and pictures were taken using a ZEN lite software on ZEISS Axiocam ERc5s digital camera (Nguyen et al., 2017). For molecular studies, Primers D2A (5′-ACAAGTACCGTGGGGAAA GTTG-3′) and D3B (5′-TCGGAAGGAACCAGCTAC TA-3′) were used to amplify D2D3 of 28S rDNA region (Nguyen et al., 2017). Obtained sequence was used for a Blast search in GenBank (Altschul et al., 1997). The data set was analyzed using maximum likelihood (ML) method in MEGA 6 program with

Thi Duyen Nguyen, Huu Tien Nguyen, Thi Mai Linh Le, Thi Tuyet Thu Tran, Neriza Nobleza, Quang Phap Trinh

Journal of Nematology , 1–4

research-article

First report of Meloidogyne javanica infecting Zinnia elegans in Ceará State, Brazil

were prepared according to Taylor and Netscher (1974). The determination of the esterase profile was made according to Carneiro and Almeida (2001), using 20 female. For molecular identification, the D2 to D3 region of 28S rDNA segment was amplified and sequenced using the primers D2A (5′-ACAAGTACCGTGAGGGAAAGTTG-3′) and D3B (5′-TCGGAAGGAACCAGCTACTA-3′) (De Ley et al., 1999) and ITS primers with VRAIN2F (5′-CTTTGTACACACCGCCCGTCGCT-3′) and VRAIN2R (5′-TTTCACTCGCCGTTACTAAGGGAATC-3′) (Vrain et al., 1992

Francisco Jorge Carlos Souza Junior, Mayara Castro Assunção

Journal of Nematology , 1–4

research-article

New data on known species of Hirschmanniella and Pratylenchus (Rhabditida, Pratylenchidae) from Iran and South Africa

(Majd Taheri et al., 2013). Those species have been studied by morphological characters except for two unknowns which have been studied by morphological and molecular DNA barcoding using 28S rDNA (Majd Taheri et al., 2013). Root-lesion nematodes, Pratylenchus (Filipjev, 1936), are after root-knot and cyst nematodes listed as the third economically most important genus that adversely affects crop production worldwide (Castillo and Vovlas, 2007; Jones et al., 2013). Pratylenchus hippeastri, the

Ebrahim Shokoohi, Joaquín Abolafia, Phatu William Mashela, Nafiseh Divsalar

Journal of Nematology , 1–26

Article

Discopersicus n. gen., a New Member of the Family Tylenchidae Örley, 1880 with Detailed SEM Study on Two Known Species of the Genus Discotylenchus Siddiqi, 1980 (Nematoda; Tylenchidae) from Iran

ALI YAGHOUBI, EBRAHIM POURJAM, SERGIO A LVAREZ-ORTEGA, GRACIA LIE´BANAS, MOHAMMAD REZA ATIGHI, MAJID PEDRAM

Journal of Nematology , ISSUE 3, 214–221

Research Article

First Reports, Morphological, and Molecular Characterization of Longidorus caespiticola and Longidorus poessneckensis (Nematoda: Longidoridae) from Ukraine

SOLOMIA SUSULOVSKA, PABLO CASTILLO, ANTONIO ARCHIDONA-YUSTE

Journal of Nematology , ISSUE 4, 396–402

research-article

Characterization of Vittatidera zeaphila (Nematoda: Heteroderidae) from Indiana with molecular phylogenetic analysis of the genus

sequences that overlapped with a 540 bp region from JF741961 previously described from the TN population of V. zeaphila (Bernard et al., 2010). Except for a few ambiguous positions in the latter sequence (possible sequencing artifacts), the ITS sequences from both populations were identical. 28S rDNA sequences obtained from four J2 were assembled into a 762 bp alignment along with JF741960 previously described from the TN population of V. zeaphila, differing at 0 to 2 bp from each other and from the TN

Andrea M. Skantar, Zafar A. Handoo, Mihail R. Kantor, Lynn K. Carta, Jamal Faghihi, Virginia Ferris

Journal of Nematology , 1–8

research-article

First report of Meloidogyne hapla on kiwifruit in South Africa

using CLUSTAL W (Thompson et al., 1994). The length of each alignment was 946 and 1186 bp for ITS rDNA and 28S rDNA, respectively. Bayesian inference was used to reconstruct the phylogeny, with Bayesian trees generated using the Bayesian inference method as implemented in the program MrBayes 3.1.2 (Ronquist and Huelsenbeck, 2003). The GTR + I + G model was selected using jModeltest 2.1.10 (Guindon and Gascuel, 2003; Darriba et al., 2012). Analysis using the GTR + I + G model was initiated with a

Ebrahim Shokoohi, Phatu W. Mashela

Journal of Nematology , 1–5

Article

Data on Some Species of the Genus Coslenchus Siddiqi, 1978 (Rhabditida, Tylenchidae) from Iran

phylogenetic studies based on partial sequences of 28S rDNA D2/D3 fragments, all species formed a clade with high Bayesian posterior probability in Bayesian inference, indicating the monophyly of the genus. The clade of Coslenchus spp. formed a highly supported monophyletic group, a sister clade to two species of the genus Aglenchus.

YOUSEF PANAHANDEH, EBRAHIM POURJAM, MAJID PEDRAM

Journal of Nematology , ISSUE 4, 268–279

Original Paper

Aspergillus penicillioides Speg. Implicated in Keratomycosis

of the following rDNA regions: ITS1, ITS2, 5.8S, 28S rDNA, LSU and β-tubulin were carried out for the isolates studied. A high level of similarity was found between sequences from certain rDNA regions, i.e. ITS1-5.8S-ITS2 and LSU, what confirmed the classification of the isolates to the species A. penicillioides. The classification of our isolates to A. penicillioides species was confirmed also by the phylogenetic analysis.

EULALIA MACHOWICZ-MATEJKO, AGNIESZKA FURMAŃCZYK, EWA DOROTA ZALEWSKA

Polish Journal of Microbiology , ISSUE 4, 407–416

Article

Taxonomy and Systematics of the Genus Makatinus Heyns, 1965 (Nematoda: Dorylaimida: Aporcelaimidae)

The taxonomy and the systematics of the genus Makatinus are discussed by means of the characterization of its morphological pattern and the first molecular (D2–D3 expansion segments of 28S rDNA) analysis of a representative of this taxon, Makatinus crassiformis from Costa Rica. The presence of two or more pairs of male ad-cloacal genital papillae is the most characteristic autapomorphy of the genus, but the status of its species on this concern differ among them. Both morphological and

REYES PENA-SANTIAGO, INGRID VARELA

Journal of Nematology , ISSUE 3, 245–253

Research Article

Two nematodes (Nematoda: Diplogastridae, Rhabditidae) from the invasive millipede Chamberlinius hualienensis Wang, 1956 (Diplopoda, Paradoxosomatidae) on Hachijojima Island in Japan

juvenile Oscheius rugaoensis (Zhang et al., 2012) Darsouei et al., 2014 (Rhabditidae), and juvenile and adult Mononchoides sp. (Diplogastridae) based on images, morphometrics, and sequences of 18S and 28S rDNA. A novel short 28S sequence of a separate population of Oscheius necromenus SB218 from Australian millipedes was also included in a phylogenetic comparison of what can now be characterized as a species complex of millipede-associated Oscheius. The only other nematode associates of millipedes

L. K. Carta, W. K. Thomas, V. B. Meyer-Rochow

Journal of Nematology , ISSUE 4, 479–486

research-article

First report of Mesocriconema xenoplax (Nematoda: Criconematidae) from turfgrass in Portugal and in Europe

M. L. Inácio, L. C. Rusinque, M. J. Camacho, F. Nóbrega

Journal of Nematology , 1–6

research-article

First report of the stubby-root nematode Nanidorus minor infecting Paspalum vaginatum, seashore paspalum grass in Georgia, USA

, the mixture was incubated at room temperature (23 ± 2°C) for 10 min and then at 95°C for 3 min. Finally, 20 µL of neutralization solution was added to the tube and vortexed briefly. This DNA extract was stored at −20°C and used as DNA template for PCR reactions in 2 µL aliquots. Three primer pairs targeting 18S rDNA (360F/932R), 28S rDNA (D2A/D3B) and ITS1 rDNA (BL18/5818) (Riga et al., 2007; Duarte et al., 2010; Ye et al., 2015) were used in singleplex PCR (Hajihassani et al., 2018a). The

Ganpati B. Jagdale, Fereidoun Forghani, Katherine Martin, Abolfazl Hajihassani, Alfredo Dick Martinez-Espinoza

Journal of Nematology , 1–3

Article

A New Species of the Rare Genus Anguillonema Fuchs, 1938 (Nematoda: Hexatylina, Sphaerularioidea) with Its Molecular Phylogenetic Study

monodelphic-prodelphic reproductive system, 15 to 19 mm long conical tail with broad rounded tip, and males absent. The new species is compared with two known species of the genus, Anguillonema poligraphi and A. crenati. Molecular phylogenetic studies of the new species using partial sequences of small subunit (SSU) rDNA revealed that it forms a clade with an unidentified nematode species and two species of the genus Howardula. In phylogenetic analyses using partial sequences of the 28S rDNA (D2-D3

MAHYAR MOBASSERI, MAJID PEDRAM, EBRAHIM POURJAM

Journal of Nematology , ISSUE 3, 286–294

Research Article

First report of Bursaphelenchus antoniae from Pinus strobus in the U.S.

only 95% similarity with PWN B. xylophilus. Compared to the previously described Portuguese population of B. antoniae, the sequences generated for the MA population were 98.3% similar in the ITS1, 2 rDNA and 99.9% similar for 28S rDNA. There was 99.2% similarity between the COI sequences of the US and Portuguese isolates of B. antoniae. This population has morphology consistent with that of Penas et al., 2006; however, the female tail on this MA pine population is mucronate and more attenuated than

Lynn K. Carta, R. L. Wick

Journal of Nematology , ISSUE 4, 473–478

research-article

Morphological and molecular characterization of Pungentus sufiyanensis n. sp. and additional data on P. engadinensis (Altherr, 1950) Altherr, 1952 (Dorylaimida: Nordiidae) from northwest of Iran

transferred to an Eppendorf tube containing 25.65 μl ddH2O, 2.85 μl 10 × PCR buffer and 1.5 μl proteinase K (600 μg/ml) (Promega, Benelux, the Netherlands). The tubes were incubated at −80°C (1 h), 65°C (1 h) and 95°C (15 min). The extracted DNA was stored at −20°C until use. The D2-D3 domains of the 28S rDNA were amplified with forward primer D2A (5´-ACAAGTACCGTGAGGGAAAGTTG-3´) and reverse primer D3B (5´-TCGGAAGGAACCAGCTACTA-3´) (Nunn, 1992). In total, 25 μl PCR reaction mixture was prepared constituting

Nasir Vazifeh, Gholamreza Niknam, Habibeh Jabbari, Reyes Peña-Santiago

Journal of Nematology , 1–12

Research Article

Occurrence of Sheraphelenchus sucus (Nematoda: Aphelenchoidinae) and Panagrellus sp. (Rhabditida: Panagrolaimidae) Associated with Decaying Pomegranate Fruit in Italy

rRNA gene, D2–D3 expansion domains of the 28S rDNA, the ITS region, and the partial mitochondrial COI were carried out. Sequences of the 18S rRNA gene, the D2–D3 domains, and the ITS were analyzed using several methods for inferring phylogeny to reconstruct the relationships among Sheraphelenchus and Bursaphelenchus species. The bacterial feeder Panagrellus sp. was characterized at the molecular level only. The D2–D3 expansion domains and ITS sequences of this Italian panagrolaimid were determined

ELENA FANELLI, ALBERTO TROCCOLI, NICOLA VOVLAS, GIANLUCA SCARCIA, ANNAMARIA MINCUZZI, SIMONA M. SANZANI, ANTONIO IPPOLITO, FRANCESCA DE LUCA

Journal of Nematology , ISSUE 4, 418–426

research-article

Description of Oscheius indicus n. sp. (Rhabditidae: Nematoda) from India

28s rDNA gene (Nunn, 1992). The amplification of near full length 18s rDNA gene was attempted by primers SSU_F_07 (AAAGATTAAGCCATGCATG) and SSU_R_81 (TGATCCWKCYGCAGGTTCAC) (Gutiérrez-Gutiérrez et al., 2012). Each PCR reaction comprised of 1 unit of Platinum Taq polymerase (Invitrogen Carlsbad, CA, USA), 1x Taq polymerase buffer, 0.2 mM dNTPs, 1.5 mM MgCl2, 0.4 µM forward and reverse primers and 6 µl of template DNA. The thermocycling conditions for ITS were – Initial denaturation at 95 °C for 5

Puneet Kumar, Wajih Jamal, Vishal S. Somvanshi, Khushbu Chauhan, Sabia Mumtaz

Journal of Nematology , 1–11

Research Article

Stauratostoma shelleyi n. gen., n. sp. (Nematoda: Rhabditida: Thelastomatidae) from Appalachian Polydesmid Millipedes (Polydesmida: Xystodesmidae)

Gary Phillips, Robert J. Pivar, Xiocaun Sun, John K. Moulton, Ernest C. Bernard

Journal of Nematology , ISSUE 2, 133–146

research-article

Description of Rotylenchus rhomboides n. sp. and a Belgian population of Rotylenchus buxophilus (Tylenchomorpha: Hoplolaimidae)

morphology and morphometrics along with molecular characteristics and phylogeny of the D2-D3 expansion segment of 28S rDNA, ITS rDNA, and COI mtDNA sequences. Materials and methods Sampling and nematode extraction The soil and root samples were collected around the rhizosphere of banana (Musa basjoo Siebold & Zucc. ex Iinuma) (GPS coordinates N: 51°2′6.8″, E: 3°43′22.7″) and Yam (Dioscorea tokoro) (GPS coordinates: N: 51°2′6.9″, E: 3°43′22.6″) at the Botanical garden of Ghent University. The nematodes

Huu Tien Nguyen, Quang Phap Trinh, Marjolein Couvreur, Phougeishangbam Rolish Singh, Wilfrida Decraemer, Wim Bert

Journal of Nematology , 1–20

research-article

PCR amplification of a long rDNA segment with one primer pair in agriculturally important nematodes

Eukaryotic nuclear ribosomal DNA (rDNA) is arranged in tandem repeat arrays in the genome. Each repeat unit consists of one copy of small subunit (SSU) 18S, internal transcribed spacers (ITS1 and ITS2), 5.8S, and large subunit (LSU) 28S rDNA, and is separated by an external transcribed spacer (EST) and an intergenic spacer (IGS) (Hillis and Dixon, 1991). The copy number of the repeats within most eukaryotic genomes is high, which provide large quantities of template DNA for PCR. In

L. K. Carta, S. Li

Journal of Nematology , 1–8

research-article

Morphological and molecular characterization of Acrobeloides saeedi Siddiqi, De Ley and Khan, 1992 (Rhabditida, Cephalobidae) from India and comments on its status

between present strains of Acrobeloides and already described species. S. No. 28S rDNA Country 1 2 3 4 5 6 7 8 9 10 11 12 13 14 1 MK935147 A. saeedi KMW India 1 1 5 5 5 38 51 59 67 74 75 76 76 2 MN101167 A. saeedi DH1 India 100 0 5 5 5 38 51 59 68 74 75 77 77 3 KY914573 A. saeedi Iran 100 100 10 10 10 38 56 64 68 79 80 82 82 4 MF325168 A. sexlineatus Germany 98.9 98.9 98.0 0 0 5 8 0 11 0 0 0 0 5

Aasha Rana, Aashaq Hussain Bhat, Suman Bhargava, Ashok Kumar Chaubey, Joaquín Abolafia

Journal of Nematology , 1–21

No Record Found..
Page Actions