Search

  • Select Article Type
  • Abstract Supplements
  • Blood Group Review
  • Call to Arms
  • Hypothesis
  • In Memoriam
  • Interview
  • Introduction
  • Short Report
  • abstract
  • Abstracts
  • Article
  • book-review
  • case-report
  • case-study
  • Clinical Practice
  • Commentary
  • Conference Presentation
  • conference-report
  • congress-report
  • Correction
  • Editorial
  • Editorial Comment
  • Erratum
  • Events
  • Letter
  • Letter to Editor
  • mini-review
  • minireview
  • News
  • non-scientific
  • Obituary
  • original-paper
  • Original Research
  • Pictorial Review
  • Position Paper
  • Practice Report
  • Preface
  • Preliminary report
  • Product Review
  • rapid-communication
  • Report
  • research-article
  • Research Communicate
  • research-paper
  • Research Report
  • Review
  • review -article
  • review-article
  • Review Paper
  • Sampling Methods
  • Scientific Commentary
  • short-communication
  • short-report
  • Student Essay
  • Varia
  • Welome
  • Select Journal
  • Journal Of Nematology

 

research-article

Morphological and Molecular Characterization of Coslenchus paramaritus n. sp. and C. cancellatus (Cobb, 1925) Siddiqi, 1978 (Nematoda: Tylenchidae) from Iran

microscope eye-piece camera in conjunction with its Dino Capture version 2.0 software. Specimens were identified at species level using available identification keys (Geraert, 2008). DNA extraction, PCR and sequencing Nematode DNA was extracted from single individuals and stored at −20°C until used as PCR template. DNA extraction was performed using the protocols described by Tanha Maafi et al. (2003). The D2–D3 expansion fragments of 28S rRNA were amplified using the forward D2A (5

Manouchehr Hosseinvand, Ali Eskandari, Reza Ghaderi

journal of nematology , 1–10

research-article

Molecular characterization of the Pratylenchus vulnus populations on cereals in Turkey

Vovlas, 2007). Molecular techniques as RAPD-PCR and sequencing of D2 to D3 expansion segments of the 28S rRNA was used for the identification of P. vulnus on different plant species (Subbotin et al., 2008; Bakooie et al., 2012; Lopez-Nicora et al., 2012). Moreover, real-time PCR provides sensitive identification of the species with species-specific primers using 1/128 of the DNA of one nematode (Huang and Yan, 2017). Pratylenchus vulnus (Allen and Jensen, 1951) (walnut root lesion nematode) has been

Mehmet Sait Karaca, Elif Yavuzaslanoglu, Gul Imriz, Ozlem Ates Sonmezoglu

Journal of Nematology , 1–4

research-article

Description and molecular phylogeny of Mesocriconema abolafiai n. sp. (Nematoda: Criconematidae) from Iran

For DNA amplification the protocol described by Tanha Maafi et al. (2003) was used. The D2 to D3 expansion regions of the 28S rRNA gene was amplified with the forward D2A (5´-ACAAGTACCGTGAGGGAAAGTTG-3´) and the reverse D3B (5´-TCGGAAGGAACCAGCTACTA-3´) primers (Nunn, 1992). The 18S rRNA was amplified as two partially overlapping fragments, using three universal and one nematode-specific primer (1912R). First 18S fragment forward primer 988F (5´-CTCAAAGATTAAGCCATGC-3´) and reverse primer 1912R (5

Hossein Mirbabaei Karani, Ali Eskandari, Reza Ghaderi, Akbar Karegar

Journal of Nematology , 1–17

Article

Molecular and Morphological Characterization of Xiphinema chambersi Population from Live Oak in Jekyll Island, Georgia, with Comments on Morphometric Variations

rounded and set off from head; total stylet length 170 to 193 mm; vulva at 20.4% to 21.8% of body length; a monodelphic, posterior reproductive system; elongate, conoid tail with a blunt terminus and four pairs of caudal pores, of which two pairs are subdorsal and two subventral. Sequence data from the D2–D3 region of the 28S rRNA molecule subjected to GenBank sequence comparison using BLAST showed that the sequence had 96% and 99% similarity with X. chambersi from Alabama

ZAFAR A. HANDOO, LYNN K. CARTA, ANDREA M. SKANTAR, SERGEI A. SUBBOTIN, STEPHEN W. FRAEDRICH

Journal of Nematology , ISSUE 1, 20–27

Research Article

First Report of Bitylenchus hispaniensis, Pratylenchoides alkani, and Helicotylenchus vulgaris in Association with Cultivated and Wild Olives in Crete, Greece and Molecular Identification of Helicotylenchus microlobus and Merlinius brevidens

Emmanuel A. Tzortzakakis, Carolina Cantalapiedra-Navarrete, Maria Kormpi, Maria S. Lazanaki, Pablo Castillo, Antonio Archidona-Yuste

Journal of Nematology , ISSUE 3, 413–418

research-article

Mitochondrial COI gene is valid to delimitate Tylenchidae (Nematoda: Tylenchomorpha) species

sequences for the identification of Tylenchidae species; and compare the resolution, sequences variability, and tree topologies obtained from one COI and two rRNA markers (i.e. 18S and the 28S rRNA). Materials and methods Samples collection and processing Soil samples were collected in China from 2018 to 2019. The details on sampling locations and habitats were given in Table 1. The nematodes were extracted from soil samples by Baermann tray and subsequently collected by a 400 mesh sieve (37 μm

Mengxin Bai, Xue Qing, Kaikai Qiao, Xulan Ning, Shun Xiao, Xi Cheng, Guokun Liu

Journal of Nematology , 1–12

research-article

First report of the dagger nematode Xiphinema pachtaicum on onion in Morocco

and yellowing of leaves. To confirm the identity of X. pachtaicum, DNA was extracted from single females (n = 2) by using the protocol described by Holterman et al. (2006). Two primers were used: forward D2a (5′ ACAAGTACCGTGAGGGAAAGTTG 3′) and reverse D3b (5′ TGCGAAGGAACCAGCTACTA 3′) for the amplification of the D2D3 region of 28S rRNA (Nunn, 1992). The PCR products (represented by accession Nos. MK622911 and MK622912) were sequenced, aligned and compared with published sequences by means of

Fouad Mokrini, Abdelfattah Dababat

Journal of Nematology , 1–2

research-article

First report of potato rot nematode, Ditylenchus destructor Thorne, 1945 infecting Codonopsis pilosula in Gansu province, China

Chunhui Ni, Shuling Zhang, Huixia Li, Yonggang Liu, Wenhao Li, Xuefen Xu, Zhipeng Xu

Journal of Nematology , 1–2

research-article

Morphological and molecular characterization of Labronema montanum sp. n. (Dorylaimida, Dorylaimidae) from Spain

final volume of 25 μl. The primers used for amplification of the D2-D3 region of 28S rRNA gene were the D2A (5′-ACAAGTACCGTGAGGGAAAGTTG-3′) and the D3B (5′-TCGGAAGGAACCAGCTACTA-3′) primers (De Ley et al., 1999). PCR cycle conditions were as follows: one cycle of 94°C for 3 min, followed by 35 cycles of 94°C for 1 min + annealing temperature of 55°C for 45 s + 72°C for 2 min, and finally one cycle of 72°C for 10 min. After DNA amplification, 5 μl of product was loaded on a 1% agarose gel in 0.5% Tris

R. Peña-Santiago, J. Abolafia

Journal of Nematology , 1–11

research-article

Characterization of a population of Pelodera strongyloides (Nematoda: Rhabditidae) associated with the beetle Lucanus ibericus (Coleoptera: Lucanidae) from Georgia

. In the present study, a Georgian population of P. strongyloides recovered for the first time from L. ibericus and was fully characterized by morphology and morphometrics. Furthermore, the PCR amplification and sequencing of the D2 to D3 expansion domains of the 28S rRNA gene, the ITS, and the mitochondrial COI were carried out. The phylogenetic relationships of P. strongyloides from Georgia to other Pelodera species and Rhabditidae were also reconstructed. Materials and methods Nematode

O. Gorgadze, A. Troccoli, E. Fanelli, E. Tarasco, F. De Luca

Journal of Nematology , 1–12

Research Article

Nothotylenchus andrassy n. sp. (Nematoda: Anguinidae) from Northern Iran

anus distance); and elongate, conical tail with pointed tip. Nothotylenchus andrassy n. sp. is morphologically similar to five known species of the genus, namely Nothotylenchus geraerti, Nothotylenchus medians, Nothotylenchus affinis, Nothotylenchus buckleyi, and Nothotylenchus persicus. The results of molecular analysis of rRNA gene sequences, including the D2–D3 expansion region of 28S rRNA, internal transcribed spacer (ITS) rRNA and partial 18S rRNA gene are provide for the new species.

Parisa Jalalinasab, Mohsen Nassaj Hosseini, Ramin Heydari

Journal of Nematology , ISSUE 2, 219–228

Research Article

Characterization of Meloidogyne indica (Nematoda: Meloidogynidae) Parasitizing Neem in India, with a Molecular Phylogeny of the Species

juveniles, males and females were carried out by light compound and scanning electron microscopy. Gross morphology and measurements were found consistent with the original description of M. indica infecting citrus by Whitehead (1968). The neem population was found to infect and reproduce on citrus. Additionally, evolutionary relationship was deduced by Maximum likelihood method using ITS rRNA, D2D3 expansion segment of 28S rRNA and mitochondrial COI sequences. Phylogenetic analyses based on these

Victor Phani, Satyapal Bishnoi, Amita Sharma, Keith G. Davies, Uma Rao

Journal of Nematology , ISSUE 3, 387–398

Research Article

First report of Pratylenchus vulnus associated with apple in Tunisia

. Microscopic observation of females and males demonstrated the occurrence of Pratylenchusd vulnus on apple trees. The ribosomal DNA D2-D3 expansion segments of the 28S rRNA and of the Pratylenchus populations were PCR amplified and sequenced. The sequences were compared with those of Pratylenchus species in the GenBank database with high similarity (99%). This comparison reconfirmed the morphological identifications. Phylogenetic studies placed those populations with P. vulnus. This is the first report of

Noura Chihani-Hammas, Lobna Hajji-Hedfi, Hajer Regaieg, Asma Larayedh, Ahmed Badiss, Yu Qing, Horrigue-Raouani Najet

Journal of Nematology , ISSUE 4, 579–586

Article

Paurodontella parapitica n. sp. (Nematoda: Hexatylina, Sphaerularioidea) from Kermanshah Province, Western Iran

inner incisures weakly crenated, excretory pore situated 90 to 100 mmfrom anterior end; functional males common in the population, with spicules 24 to 26 mmlong. Tail of both sexes similar, almost straight and elongate-conoid. The new species resembles in morphology and morphometrics to four known species of the genus, namely P. apitica, P. minuta, P. myceliophaga, and P. sohailai. The results of phylogenetic analyses based on sequences of D2/D3 expansion region of 28S rRNA gene

MEHRAB ESMAEILI, RAMIN HEYDARI, WEIMIN YE

Journal of Nematology , ISSUE 2, 109–115

research-article

Description of Deladenus gilanica n. sp. (Hexatylina: Neotylenchidae) isolated from wood of black pine in Northern Iran

extracts were stored at −20°C until used as template for PCR amplification. The D2/D3 expansion segment of 28S rRNA gene was amplified using the forward D2A (5´–ACAAGTACCGTGAGGGAAAGTTG–3´) and reverse D3B (5´–TCGGAAGGAACCAGCTACTA–3´) primers (Nunn, 1992) and the partial 18S was amplified using primers 1096F (5´–GGTAATTCTGGAGCTAATAC-3´) and 1912R (5´–TTTACG GTCAGAACTAGGG–3´) (Holterman et al., 2006). PCR cycle conditions for all rDNA regions were as follows: one cycle of 94°C for 2 min, followed by 35

Parisa Jalalinasab, Mehrab Esmaeili, Weimin Ye, Ramin Heydari

Journal of Nematology , 1–10

research-article

Aphelenchus yinyuensis n. sp. (Tylenchina: Aphelenchoididae) found in Terminalia sp. in China

Gu Jianfeng, Munawar Maria, Yiwu Fang, Liu Lele, Xianfeng Chen, Bo Cai

Journal of Nematology , 1–12

Research Article

First Reports, Morphological, and Molecular Characterization of Longidorus caespiticola and Longidorus poessneckensis (Nematoda: Longidoridae) from Ukraine

processed to glycerol and mounted on permanent slides and subsequently identified morphologically and molecularly. Nematode DNA was extracted from single individuals and PCR assays were conducted as previously described for D2–D3 expansion segments of 28S rRNA. Sequence alignments for D2–D3 from L. caespiticola showed 97%–99% similarity to other sequences of L. caespiticola deposited in GenBank from Belgium, Bulgaria, Czech Republic, Russia, Slovenia, and Scotland. Similarly, D2–D3 sequence alignments

SOLOMIA SUSULOVSKA, PABLO CASTILLO, ANTONIO ARCHIDONA-YUSTE

Journal of Nematology , ISSUE 4, 396–402

research-article

Characterization of root-knot nematodes infecting mulberry in Southern China

%) to sequences of Meloidogyne enterolobii. The phylogenetic tree inferred from rDNA-ITS (Fig. 2) suggests that MK850135, MN102393, and Meloidogyne enterolobii (KX823381.1 and KX823382.1) are in the monophyletic clade, while MK850136, MK850137, MK850138, and MK116406 are in another monophyletic clade in relation to a population of Meloidogyne enterolobii (KX823381.1 and KX823382.1). The phylogenetic tree inferred from the D2-D3 region of the 28S rRNA (Fig. 3) indicated that MN01721, MN01724

Pan Zhang, Hudie Shao, Chunping You, Yan Feng, Zhenwen Xie

Journal of Nematology , 1–8

Research Article

First Report of Stubby-Root Nematode, Paratrichodorus minor, on Onion in Georgia, U.S.A

segments of 28S rRNA, and ITS1 rDNA were amplified using primer pairs 360F (5′ CTACCACATCCAAGGAAGGC 3′)/932R (5′ TATCTGATCGCTGTCGAACC 3′), D2A (5′ ACAAGTACCGTGAGGGAAAGTTG 3′)/D3B (5′ TCGGAAGGAACCAGCTACTA 3′), and BL18 (5′ CCCGTCGCTACTACCGATT 3′)/5818 (5′ ACGARCCGAGTGATCCAC 3′), respectively (Riga et al., 2007; Duarte et al., 2010; Ye et al., 2015; Shaver et al., 2016). The obtained PCR fragments were purified using QIAquick Gel Extraction Kit (Qiagen Inc., Santa Clara, CA, USA), sequenced and deposited

Abolfazl Hajihassani, Negin Hamidi, Bhabesh Dutta, Chris Tyson

Journal of Nematology , ISSUE 3, 453–455

research-article

Meloidogyne aegracyperi n. sp. (Nematoda: Meloidogynidae), a root-knot nematode parasitizing yellow and purple nutsedge in New Mexico

MRG YGA TYA GAT ACC GCY PCR 18S rRNA 1629 R deg GGT GTG TAC AAA KSR CAG GGA PCR 18S rRNA 79 F deg GDG AAACYG CGWACG GCT PCR 18S rRNA RKN-5R TCG AAC ATG TCA AAA GGA GC PCR and sequencing HSP90 RKN-d1F GCY GAT CTT GTY AAC AAC CYT GGA AC PCR and sequencing HSP90 For the amplification of the D2-D3 region of the 28S rRNA, the forward D2A (5′-ACAAGTACCGTGAGGGAAAGTTG-3′) and the reverse D3B (5′-TCGGAAGGAACCAGCTACTA-3′) primers were used (De Ley et al., 1999). For amplification of the ITS1

J. D. Eisenback, L. A. Holland, J. Schroeder, S. H. Thomas, J. M. Beacham, S. F. Hanson, V. S. Paes-Takahashi, P. Vieira

journal of nematology , 1–16

No Record Found..
Page Actions