Search

  • Select Article Type
  • Abstract Supplements
  • Blood Group Review
  • Call to Arms
  • Hypothesis
  • In Memoriam
  • Interview
  • Introduction
  • Short Report
  • abstract
  • Abstracts
  • Article
  • book-review
  • case-report
  • case-study
  • Clinical Practice
  • Commentary
  • Conference Presentation
  • conference-report
  • congress-report
  • Correction
  • Editorial
  • Editorial Comment
  • Erratum
  • Events
  • Letter
  • Letter to Editor
  • mini-review
  • minireview
  • News
  • non-scientific
  • Obituary
  • original-paper
  • Original Research
  • Pictorial Review
  • Position Paper
  • Practice Report
  • Preface
  • Preliminary report
  • Product Review
  • rapid-communication
  • Report
  • research-article
  • Research Communicate
  • research-paper
  • Research Report
  • Review
  • review -article
  • review-article
  • Review Paper
  • Sampling Methods
  • Scientific Commentary
  • short-communication
  • short-report
  • Student Essay
  • Varia
  • Welome
  • Select Journal
  • Journal Of Nematology

 

research-article

A COI DNA barcoding survey of Pratylenchus species in the Great Plains Region of North America

. scribneri in corn fields of Iowa (Norton, 1983). Todd et al. (2014) reported P. neglectus and P. thornei Sher & Allen, 1953 in wheat fields of Kansas and Colorado. This accounting of Pratylenchus species reported from the Great Plains region totals nine different species, not including P. agilis. The objectives of this study were to (i) barcode Pratylenchus specimens for species identification across the Great Plains region using the cytochrome oxidase subunit 1 (COI) gene of the mitochondrial DNA

Mehmet Ozbayrak, Tim Todd, Timothy Harris, Rebecca Higgins, Kirsten Powers, Peter Mullin, Lisa Sutton, Thomas Powers

Journal of Nematology , 1–21

research-article

Mitochondrial COI gene is valid to delimitate Tylenchidae (Nematoda: Tylenchomorpha) species

et al., 2006; Subbotin et al., 2006). However, rRNA genes are problematic in Tylenchidae phylogeny and the unresolved status is unlikely to be improved by intensive species sampling (Qing et al., 2017; Qing and Bert, 2019). Therefore, finding a proper molecular marker gene is crucial for the Tylenchidae study. In this study we examined the mitochondrial Cytochrome Oxidase I gene (COI) of 12 species belong to Tylenchidae (sensu (Geraert, 2008)), the goal is to evaluate the potential of COI

Mengxin Bai, Xue Qing, Kaikai Qiao, Xulan Ning, Shun Xiao, Xi Cheng, Guokun Liu

Journal of Nematology , 1–12

research-article

DNA barcoding evidence for the North American presence of alfalfa cyst nematode, Heterodera medicaginis

alfalfa (https://nematode.unl.edu/hetemedic.htm) in the Great Plains state of Kansas in the US. A follow-up of these reports, utilizing morphology, host trials, and DNA barcoding using the mitochondrial gene COI along with ITS1, the transcribed spacer region between 18S and 5.8S of the nuclear ribosomal repeat region, and the heat shock protein gene Hsp90 provide supporting evidence that Heterodera medicaginis is present in the US. Materials and methods Nematode collections The original North

Thomas Powers, Andrea Skantar, Tim Harris, Rebecca Higgins, Peter Mullin, Saad Hafez, Zafar Handoo, Tim Todd, Kirsten Powers

Journal of Nematology , 1–17

Research Article

Discovery and Identification of Meloidogyne Species Using COI DNA Barcoding

Thomas Powers, Timothy Harris, Rebecca Higgins, Peter Mullin, Kirsten Powers

Journal of Nematology , ISSUE 3, 399–412

Research Article

Characterization of Meloidogyne indica (Nematoda: Meloidogynidae) Parasitizing Neem in India, with a Molecular Phylogeny of the Species

juveniles, males and females were carried out by light compound and scanning electron microscopy. Gross morphology and measurements were found consistent with the original description of M. indica infecting citrus by Whitehead (1968). The neem population was found to infect and reproduce on citrus. Additionally, evolutionary relationship was deduced by Maximum likelihood method using ITS rRNA, D2D3 expansion segment of 28S rRNA and mitochondrial COI sequences. Phylogenetic analyses based on these

Victor Phani, Satyapal Bishnoi, Amita Sharma, Keith G. Davies, Uma Rao

Journal of Nematology , ISSUE 3, 387–398

Research Article

First Report of Carrot Cyst Nematode Heterodera carotae in Mexico: Morphological, Molecular Characterization, and Host Range Study

was made using light and scanning electron microscopy of the second stage juveniles, females, males and cysts, and the host range study, was performed with nine different plants from five families. The molecular identification was made by sequencing and analysing the ITS rRNA and partial COI genes. It was shown that using presently available molecular tools it is not possible to make an accurate differentiation of H. carotae from H. cruciferae. The host range test allowed to distinguish these

Ilia Mariana Escobar-Avila, Edgar Óliver López-Villegas, Sergei A. Subbotin, Alejandro Tovar-Soto

Journal of Nematology , ISSUE 2, 229–242

research-article

Characterization of a population of Pelodera strongyloides (Nematoda: Rhabditidae) associated with the beetle Lucanus ibericus (Coleoptera: Lucanidae) from Georgia

. In the present study, a Georgian population of P. strongyloides recovered for the first time from L. ibericus and was fully characterized by morphology and morphometrics. Furthermore, the PCR amplification and sequencing of the D2 to D3 expansion domains of the 28S rRNA gene, the ITS, and the mitochondrial COI were carried out. The phylogenetic relationships of P. strongyloides from Georgia to other Pelodera species and Rhabditidae were also reconstructed. Materials and methods Nematode

O. Gorgadze, A. Troccoli, E. Fanelli, E. Tarasco, F. De Luca

Journal of Nematology , 1–12

Article

First Report and Comparative Study of Steinernema surkhetense (Rhabditida: Steinernematidae) and its Symbiont Bacteria from Subcontinental India

isolates possess six ridges in their lateral field instead of eight reported in the original description. The analysis of ITS-rDNA sequences revealed nucleotide differences at 345, 608, and 920 positions in aligned data. No difference was observed in D2-D3 domain. The S. surkhetense COI gene was studied for the first time as well as the molecular characterization of their Xenorhabdus symbiont using the sequences of recA and gyrB genes revealing Xenorhabdus stockiae as its symbiont

AASHIQ HUSSAIN BHAT, I STKHAR, ASHOK KUMAR CHAUBEY, VLADIMIR PUZA, ERNESTO SAN-BLAS

Journal of Nematology , ISSUE 1, 92–102

research-article

Plant-parasitic nematodes associated with sugarcane in Kilimanjaro, Tanzania

data by taking pictures and measurements using the above camera-equipped microscope. This was followed by DNA extraction from individual nematodes as described in the study of Singh et al. (2018) and the resulting genomic DNA sample was used for the amplification of the partial ITS and D2-D3 region of the 28S of rRNA gene and the COI gene of mtDNA. PCR amplification of the partial ITS was done using the primer pair Vrain2F: 5´-CTTTGTACACACCGCCCGTCGCT-3´/Vrain2R: 5´-TTTCACTCGCCGTTACTAAGGGAATC-3

Phougeishangbam Rolish Singh, Beatrice E. Kashando, Marjolein Couvreur, Gerrit Karssen, Wim Bert

Journal of Nematology , 1–17

research-article

Description of Deladenus brevis n. sp. (Sphaerularioidea: Neotylenchidae) from Iran: a morphological and molecular phylogenetic study

species of Deladenus was recovered from a deadwood sample of a dead forest tree collected from the forests of Golestan province, northern Iran. Thus, the present paper aims to describe the newly recovered species and resolve its phylogenetic relationships with other relevant species and genera using three SSU, LSU rDNA, and COI mtDNA markers. Materials and methods Sampling, nematode extraction, mounting, and drawing Specimens of Deladenus brevis n. sp. were obtained from the bark and rotten wood

Fariba Heydari, Joaquín Abolafia, Majid Pedram

Journal of Nematology , 1–13

research-article

Description of Rotylenchus rhomboides n. sp. and a Belgian population of Rotylenchus buxophilus (Tylenchomorpha: Hoplolaimidae)

morphology and morphometrics along with molecular characteristics and phylogeny of the D2-D3 expansion segment of 28S rDNA, ITS rDNA, and COI mtDNA sequences. Materials and methods Sampling and nematode extraction The soil and root samples were collected around the rhizosphere of banana (Musa basjoo Siebold & Zucc. ex Iinuma) (GPS coordinates N: 51°2′6.8″, E: 3°43′22.7″) and Yam (Dioscorea tokoro) (GPS coordinates: N: 51°2′6.9″, E: 3°43′22.6″) at the Botanical garden of Ghent University. The nematodes

Huu Tien Nguyen, Quang Phap Trinh, Marjolein Couvreur, Phougeishangbam Rolish Singh, Wilfrida Decraemer, Wim Bert

Journal of Nematology , 1–20

research-article

The morphological characteristics and phylogenetic analysis of Pratylenchus vulnus Taiwan strawberry isolate

Blaxter, 2003) and mtDNA COI region (JB3/JB4.5: TTTTTTGGGCATCCTGAGGTTTAT/TAAAGAAAGAACATAATGAAAATG) (Derycke et al., 2010) of the Pv-GS and Pv-KDL are 99.04, 95.96, 99.66 and 99.24% identical, respectively. Both Pv-GS and Pv-KDL isolates had maximum 100% similarity of their rDNA LSU sequences to P. vulnus (GenBank accession: U47547.1). The Pv-KDL mtDNA COI region sequences of isolates were 99.74 to 100% similar to other sequences of P. vulnus available in the database (GenBank accessions KY424094

Yu-po Lin, Wan-chun Lee, Pei-che Chung, Jiue-in Yang

Journal of Nematology , 1–5

research-article

Morpho-molecular characterization of Colombian and Brazilian populations of Rotylenchulus associated with Musa spp

processing. The D2-D3 expansion region of the large subunit (LSU) of ribosomal DNA (28 S) was amplified using primers D2A (forward, 5′-ACAAGTACCGTGAGGGAAAGTTG-3′) and D3B (reverse, 5′-TCCTCGGAAGGAACCAGCTACTA-3′) (De Ley et al., 1999). Also, a partial region of the mitochondrial cytochrome oxidase subunit I (COI) was amplified using primers JB3 (forward, 5′-TTTTTTGGGCATCCTGAGGTTTAT-3′) and JB4.5 (reverse, 5′-TAAAGAAAGAACATAATGAAAATG-3′) (Bowles et al., 1992). The PCR conditions were initial denaturation

Donald Riascos-Ortiz, Ana Teresa Mosquera-Espinosa, Francia Varón De Agudelo, Claudio Marcelo Gonçalves de Oliveira, Jaime Eduardo Muñoz-Flórez

Journal of Nematology , 1–13

research-article

De novo transcriptome sequencing and analysis of Anisakis pegreffii (Nematoda: Anisakidae) third-stage and fourth stage larvae

collagen genes (col-34, col-138, col-40) were highly expressed in APL4. Several mitochondrial enzyme genes (COI, COII, COIII) were highly expressed both in APL3 and APL4 (Tables 4 and 5). Table 4. Top 20 most abundant unigenes in A. pegreffii L3. No. ID Name Description 1 TBIU006603 COIII Cytochrome c oxidase subunit 3 2 TBIU013810 COI Cytochrome c oxidase subunit 1 3 TBIU015558 UBB Polyubiquitin-B 4 TBIU017350 ZK970.7 Protein ZK970.7 5 TBIU017923 act-2b Actin-2 6 TBIU015560

U-Hwa Nam, Jong-Oh Kim, Jeong-Ho Kim

Journal of Nematology , 1–16

Research Article

Description and Distribution of Three Criconematid Nematodes from Hangzhou, Zhejiang Province, China

Populations of Criconemoides parvus, Discocriconemella hengsungica, and Discocriconemella limitanea, isolated in Hangzhou, China from the rhizosphere soil of woody perennials were characterized morphologically and molecularly. The morphometric data of the Chinese populations were compared with populations from other regions of the world. DNA barcoding with the mitochondrial COI gene confirmed conspecificity of Chinese and Costa Rican populations of D. limitanea. Phylogenetic assessment using a

Maria Munawar, Thomas O. Powers, Zhongling Tian, Timothy Harris, Rebecca Higgins, Jingwu Zheng

Journal of Nematology , ISSUE 2, 183–206

Research Article

First report of Bursaphelenchus antoniae from Pinus strobus in the U.S.

only 95% similarity with PWN B. xylophilus. Compared to the previously described Portuguese population of B. antoniae, the sequences generated for the MA population were 98.3% similar in the ITS1, 2 rDNA and 99.9% similar for 28S rDNA. There was 99.2% similarity between the COI sequences of the US and Portuguese isolates of B. antoniae. This population has morphology consistent with that of Penas et al., 2006; however, the female tail on this MA pine population is mucronate and more attenuated than

Lynn K. Carta, R. L. Wick

Journal of Nematology , ISSUE 4, 473–478

Research Article

Occurrence of Sheraphelenchus sucus (Nematoda: Aphelenchoidinae) and Panagrellus sp. (Rhabditida: Panagrolaimidae) Associated with Decaying Pomegranate Fruit in Italy

rRNA gene, D2–D3 expansion domains of the 28S rDNA, the ITS region, and the partial mitochondrial COI were carried out. Sequences of the 18S rRNA gene, the D2–D3 domains, and the ITS were analyzed using several methods for inferring phylogeny to reconstruct the relationships among Sheraphelenchus and Bursaphelenchus species. The bacterial feeder Panagrellus sp. was characterized at the molecular level only. The D2–D3 expansion domains and ITS sequences of this Italian panagrolaimid were determined

ELENA FANELLI, ALBERTO TROCCOLI, NICOLA VOVLAS, GIANLUCA SCARCIA, ANNAMARIA MINCUZZI, SIMONA M. SANZANI, ANTONIO IPPOLITO, FRANCESCA DE LUCA

Journal of Nematology , ISSUE 4, 418–426

research-article

A loop-mediated isothermal amplification assay for the plant-parasitic nematode Aphelenchoides besseyi in rice seedlings

. Multiple sequences alignments were performed using Geneious 9.1.6 software (Biomatters Inc., CA, USA) and the mitochondria COI gene was finally selected as primer target due to its relatively high sequence variation among the Aphelenchoides species. The LAMP primers were designed using PrimerExplorer v.5 software (Eiken chemical Co., Ltd, Tokyo, Japan). Four sets of primers, AB-ID14, AB-ID30, AB-ID37 and AB-ID40, were used for further testing. Among them, the AB-ID37 set contains four primers that

Jiue-in Yang, Guan-yi Yu

Journal of Nematology , 1–11

research-article

Characterization of Vittatidera zeaphila (Nematoda: Heteroderidae) from Indiana with molecular phylogenetic analysis of the genus

 μl 50 mM MgCl2, and 2.5 µl PCR buffer in a total volume of 25 µl. PCR cycling conditions were 95°C for 3 min, 35X (94°C for 30 sec, 50°C for 40 sec, 72°C for 70 sec), 72°C for 5 min, 4°C until finish. COI: Mitochondrial cytochrome oxidase I (COI) was amplified with primers Het-coxiF [5′-TAGTTGATCGTAATTTTAATGG-3′] and Het-coxiR [5′-CCTAAAACATAATGAAAATGWGC-3′]. Amplifications were performed in 25 µl reactions with 1x PicoMaxx (Agilent) buffer, 0.2 mM dNTPs, 0.3 µM each primer, 0.125 µl Dream Taq

Andrea M. Skantar, Zafar A. Handoo, Mihail R. Kantor, Lynn K. Carta, Jamal Faghihi, Virginia Ferris

Journal of Nematology , 1–8

research-article

Molecular and morphological characterization of the amaryllis lesion nematode, Pratylenchus hippeastri (Inserra et al., 2007), from California

oxidase I (COI) was amplified with JB3 [5’-TTTTTTGGGCATCCTGAGGTTTAT-3’] and JB5 [5’-AGCACCTAAACTTAA AACATAATGAAAATG-3’] (Derycke et al., 2005) as described in Ozbayrak et al. (2019). PCR amplicons of 403 bp were cleaned and sequenced directly with the same primers. The 28 S large ribosomal subunit D2-D3 expansion segment was obtained via amplification with the primers D2A [5’-ACAAGTACCGTGAGGGAAAGTTG-3’] and D3B [5’-TCGGAAGGAACCAGCTACTA-3’] (De Ley et al., 2005; Ye et al., 2007), producing sequences of

Zafar A. Handoo, Andrea M. Skantar, Mihail R. Kantor, Saad L. Hafez, Maria N. Hult

Journal of Nematology , 1–5

research-article

New data on known species of Hirschmanniella and Pratylenchus (Rhabditida, Pratylenchidae) from Iran and South Africa

used in the PCR reactions for partial amplification of the 18S rDNA, ITS rDNA, 28S rDNA, and COI of mtDNA region. PCR was conducted with 8 µl of the DNA template, 12.5 µl of 2X PCR Master Mix Red (Promega, USA) for the South African specimens and (Pishgam, Iran) for the Iranian specimens), 1 µl of each primer (10 pmol µl−1), and ddH2O for a final volume of 30 µl. The amplification was processed using an Eppendorf master cycler gradient (Eppendorf, Hamburg, Germany), with the following program

Ebrahim Shokoohi, Joaquín Abolafia, Phatu William Mashela, Nafiseh Divsalar

Journal of Nematology , 1–26

Research Article

First Report of the Yellow Nutsedge Cyst Nematode, Heterodera cyperi, in Georgia, U.S.A.

extracted from single cysts (n = 3) and internal transcribed spacer (ITS) of rRNA and partial cytochrome oxidase I (COI) genes were amplified with primers TW81/AB28 and Het-coxiF/Het-coxiR, respectively (Subbotin et al., 2001; Subbotin, 2015) and sequenced. The resulting sequences were deposited into the GenBank database (Accession no. MG825344 and MG857126) and also subjected to BLAST searches in the database. ITS sequence of H. cyperi showed 100% similarity (100% coverage) with that of a H. cyperi

Abolfazl Hajihassani, Bhabesh Dutta, Ganpati B. Jagdale, Sergei A. Subbotin

Journal of Nematology , ISSUE 3, 456–458

research-article

First report of Meloidogyne javanica on Ginger and Turmeric in the United States

Abolfazl Hajihassani, Weimin Ye, Brooke B. Hampton

Journal of Nematology , 1–3

No Record Found..
Page Actions