Search

  • Select Article Type
  • Abstract Supplements
  • Blood Group Review
  • Call to Arms
  • Hypothesis
  • In Memoriam
  • Interview
  • Introduction
  • Short Report
  • abstract
  • Abstracts
  • Article
  • book-review
  • case-report
  • case-study
  • Clinical Practice
  • Commentary
  • Conference Presentation
  • conference-report
  • congress-report
  • Correction
  • critical-appraisal
  • Editorial
  • Editorial Comment
  • Erratum
  • Events
  • Letter
  • Letter to Editor
  • mini-review
  • minireview
  • News
  • non-scientific
  • Obituary
  • original-paper
  • original-report
  • Original Research
  • Pictorial Review
  • Position Paper
  • Practice Report
  • Preface
  • Preliminary report
  • Product Review
  • rapid-communication
  • Report
  • research-article
  • Research Communicate
  • research-paper
  • Research Report
  • Review
  • review -article
  • review-article
  • review-paper
  • Review Paper
  • Sampling Methods
  • Scientific Commentary
  • short-communication
  • short-report
  • Student Essay
  • Varia
  • Welome
  • Select Journal
  • Polish Journal Of Microbiology

 

original-paper | 03-September-2019

Prevalence and Antifungal Susceptibility of the Emerging Fungal Species, Candida nivariensis, Isolated in a Teaching Hospital in Poland

Genomic DNA Purification Kit (EurX, Poland) following the manufacturer’s guidelines. C. nivariensis and C. bracarensis identification within the C. glabrata complex. There were two stages of species identification within the Candida glabrata complex. In the first stage, the internal transcripted spacer 1 (ITS-1), characteristics of C. glabrata sensu stricto was identified using PCR. The NL-1 (5’-GCAT ATCAATAAGCGGAGGAAAAG’) and NL-4 (5’-GGT CCGTGTTTCAAGACGG’) primers were used for the amplification

MAGDALENA SIKORA, ROBERT KUTHAN, KATARZYNA PISKORSKA-MALOLEPSZA, MARLENA GOLAS-PRADZYNSKA, DARIUSZ DOMAŃSKI, EWA AUGUSTYNOWICZ-KOPEĆ, EWA SWOBODA-KOPEC

Polish Journal of Microbiology, Volume 68 , ISSUE 3, 303–308

No Record Found..
Page Actions