Search

  • Select Article Type
  • Abstract Supplements
  • Blood Group Review
  • Call to Arms
  • Communications
  • Hypothesis
  • In Memoriam
  • Interview
  • Introduction
  • Letter to the Editor
  • Short Report
  • abstract
  • Abstracts
  • Article
  • book-review
  • case-report
  • case-study
  • Clinical Practice
  • Commentary
  • Conference Presentation
  • conference-report
  • congress-report
  • Correction
  • critical-appraisal
  • Editorial
  • Editorial Comment
  • Erratum
  • Events
  • in-memomoriam
  • Letter
  • Letter to Editor
  • mini-review
  • minireview
  • News
  • non-scientific
  • Obituary
  • original-paper
  • original-report
  • Original Research
  • Pictorial Review
  • Position Paper
  • Practice Report
  • Preface
  • Preliminary report
  • Product Review
  • rapid-communication
  • Report
  • research-article
  • Research Communicate
  • research-paper
  • Research Report
  • Review
  • review -article
  • review-article
  • review-paper
  • Review Paper
  • Sampling Methods
  • Scientific Commentary
  • serologic-method-review
  • short-communication
  • short-report
  • Student Essay
  • Varia
  • Welome
  • Select Journal
  • Polish Journal Of Microbiology
  • Journal Of Nematology

 

Article | 24-July-2017

Cryptaphelenchus varicaudatus n. sp. (Rhabditida: Ektaphelenchinae) from Tehran Province, Iran

of small subunit (SSU) and large subunit (LSU) rDNA D2/D3 fragments, the new species formed a clade with two currently available GenBank-derived, unspecified isolates/sequences in SSU and three other isolates/sequences in LSU trees, respectively.

MAJID PEDRAM

Journal of Nematology, Volume 49 , ISSUE 2, 223–230

research-article | 30-November-2020

Morphological and molecular characterization of Filenchus pseudodiscus n. sp. from east Golestan province, north Iran; with an updated phylogeny of Malenchus Andrássy, 1968 (Tylenchomorpha: Tylenchidae)

the present study, two populations of the family Tylenchidae were recovered from natural forests of Golestan province, north Iran. The first species appeared as being a new member of Filenchus, and the second species belonged to Malenchus gilanensis (Jalalinasab et al., 2019). Thus, the present study aims to (i) characterize the new species using both traditional and molecular criteria, and (ii) update the phylogeny of Malenchus by including M. gilanensis in the LSU tree. Materials and methods

Parnaz Mortazavi, Fariba Heydari, Joaquín Abolafia, Pablo Castillo, Majid Pedram

Journal of Nematology, Volume 53 , 1–14

research-article | 06-November-2020

Morphological and molecular characterizations of Heterodera oryzae in Korea

: A = 100 μm, B = 50 μm, C = 50 μm, D = 100 μm, E = 20 μm, F = 10 μm, G = 50 μm, and H = 50 μm. Molecular and phylogenetic analysis ITS region, LSU D2-D3 (28S) segments, and COI gene of the mtDNA were amplified as indicated in methodology section. DNA fragment lengths after amplification showed (n = 6); 1000 bp for ITS region, 750 bp for 28S D2-D3, and 500 bp for COI gene, respectively (Fig. 3). Amplified DNA of ITS region, 28S region, and COI for SG936 and SG156 were sequenced. Reads for

Rose Mwesige, Eun-Hwa Kim, Eun-Hyung Park, Hyoung-Rai Ko

Journal of Nematology, Volume 52 , 1–12

research-article | 30-November-2020

New insights into the identity of Discolaimium dubium Das, Khan and Loof, 1969 (Dorylaimida) as derived from its morphological and molecular characterization, with the proposal of its transference to Aporcella Andrássy, 2002

. Molecular analyses of LSU rDNA sequences of three Iranian specimens of D. dubium sheds some light on the identity of this species. Their evolutionary relationships, as observed in the tree provided in Figure 4, reveal that these sequences form part of a highly supported (98%) large clade including several taxa, all of them having in common the absence of pars refringens vaginae, so confirming previous findings (Álvarez-Ortega and Peña-Santiago, 2016; Álvarez-Ortega et al., 2013; Imran et al., 2019

Nasir Vazifeh, Gholamreza Niknam, Habibeh Jabbari, Arezoo Naghavi, Reyes Peña-Santiago

Journal of Nematology, Volume 53 , 1–12

research-article | 30-November-2018

Data of an Iranian Population of L. proximus Sturhan & Argo, 1983, with taxonomic revision of L. israelensis Peneva, Orion, Shlevin, Bar-Eyal & Brown, 1998 (Nematoda: Longidoridae) and Proposal for a New Synonymy

transferred to a small drop of TE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0, QIAGEN Inc., Valencia, CA) individually on separate clean slides, and each specimen was squashed using a clean slide cover glass. The suspension was collected by adding 50 μl TE buffer. Each sample was regarded as an independent DNA sample, and stored at −20°C until used as polymerase chain reaction (PCR) template. Primers used for the PCR amplification of the D2–D3 expansion domains of the LSU rDNA were forward D2A (5

Mazdosht Giti, Leila Kashi, Majid Pedram

journal of nematology, Volume 51 , 1–11

Article | 21-July-2017

Molecular and Morphological Characterization of Aphelenchoides fuchsi sp. n. (Nematoda: Aphelenchoididae) Isolated from Pinus eldarica in Western Iran

Shahina, category of Aphelenchoides species. Phylogenetic analysis based on small subunit (SSU) and partial large subunit (LSU) sequences of rRNA supported themorphological results.

MEHRAB ESMAEILI, RAMIN HEYDARI, MOZHGAN ZIAIE, JIANFENG GU

Journal of Nematology, Volume 48 , ISSUE 1, 34–42

Research Article | 03-September-2018

Molecular Characterization and Phylogeny of Ditylenchus weischeri from Cirsium arvense in the Prairie Provinces of Canada

molecular analysis of many D. weischeri specimens from Canada is presented. Individuals from 41C. arvense or yellow pea grain samples with seeds of C. arvense from the Prairie Provinces were sequenced for the internal transcribed spacer (ITS rDNA), large subunit (LSU) D2D3 28S rDNA, partial segment of small subunit (SSU) 18S rDNA, and the heat shock protein Hsp90 gene. The analysis also included D. weischeri individuals from C. arvense from Russia and garlic with D. dipsaci from the Provinces of Ontario

Mehrdad Madani, Mario Tenuta

Journal of Nematology, Volume 50 , ISSUE 2, 163–182

Article | 21-July-2017

Sectonema caobangense sp. n. from Vietnam (Nematoda, Dorylaimida, Aporcelaimidae)

Sectonema caobangense sp. n. from evergreen forest soil in Vietnam is described, including scanning electron micrograph (SEM) observations and D2-D3 LSU rDNA analysis. The new species is characterized by its 3.12 to 5.80mmlong body, lip region offset by deep constriction and 21 to 23 mm broad, mural tooth 13 to 14 mm long at its ventral side, 940 to 1,112 mm long neck, pharyngeal expansion occupying 61% to 69% of total neck length, uterus a long simple tube-like structure 292 to 363

SERGIO ALVAREZ-ORTEGA, THI ANH DUONG NGUYEN, JOAQUI´N ABOLAFIA, MICHAEL BONKOWSKI, REYES PEN˜A-SANTIAGO

Journal of Nematology, Volume 48 , ISSUE 2, 95–103

research-article | 30-November-2019

Hemicycliophora ahvasiensis n. sp. (Nematoda: Hemicycliophoridae), and data on a known species, from Iran

the specimens were photographed using an Olympus DP72 digital camera attached to an Olympus BX51 light microscope equipped with differential interference contrast (DIC). Table 1. Information of the species/populations of Hemicycliophora studied in present paper and those of ingroup and outgroup taxa used in phylogenetic analyses. GenBank accession numbers Species Host Locality D2-D3 of LSU rDNA ITS Reference or identifier H. ahvasiensis n. sp. Phoenix dactylifera

Sedighe Azimi, Joaquín Abolafia, Majid Pedram

Journal of Nematology, Volume 52 , 1–19

research-article | 30-November-2020

Laimaphelenchus africanus n. sp. (Tylenchomorpha: Aphelenchoididae) from South Africa, a morphological and molecular phylogenetic study, with an update to the diagnostics of the genus

. The specimens were then transferred to two individual Eppendorf tubes containing 15 µl ddH2O and their respective DNA was extracted using the chelex-100 protocol of Rashidifard et al. (2019). The DNA samples were stored at –20°C until used for amplification. The partial sequences of the large subunit ribosomal DNA (LSU rDNA D2-D3) were amplified using forward primer D2A (5′–ACAAGTACCGTGAGGGAAAGT–3′) and reverse primer D3B (5′–TCGGAAGGAACCAGCTACTA–3′) (Nunn, 1992). The polymerase chain reaction (PCR

Farahnaz Jahanshahi Afshar, Milad Rashidifard, Joaquín Abolafia, Miloslav Zouhar, Hendrika Fourie, Majid Pedram

Journal Of Nematology, Volume 53 , 1–14

research-article | 30-November-2019

Description of Deladenus brevis n. sp. (Sphaerularioidea: Neotylenchidae) from Iran: a morphological and molecular phylogenetic study

species of Deladenus was recovered from a deadwood sample of a dead forest tree collected from the forests of Golestan province, northern Iran. Thus, the present paper aims to describe the newly recovered species and resolve its phylogenetic relationships with other relevant species and genera using three SSU, LSU rDNA, and COI mtDNA markers. Materials and methods Sampling, nematode extraction, mounting, and drawing Specimens of Deladenus brevis n. sp. were obtained from the bark and rotten wood

Fariba Heydari, Joaquín Abolafia, Majid Pedram

Journal of Nematology, Volume 52 , 1–13

Research Article | 03-September-2018

Stauratostoma shelleyi n. gen., n. sp. (Nematoda: Rhabditida: Thelastomatidae) from Appalachian Polydesmid Millipedes (Polydesmida: Xystodesmidae)

stomatal opening formed from four flaps; greatly expanded labial disc; and eight-sectored annule-like column supporting the labial disc. Thirteen nematodes from various hosts were sequenced for 28S LSU rDNA and compared with other millipede-inhabiting nematodes. Stauratostoma shelleyi is the sister group to the few Thelastoma spp. that have been molecularly characterized using the D2–D3 expansion segments of the 28S LSU rDNA.

Gary Phillips, Robert J. Pivar, Xiocaun Sun, John K. Moulton, Ernest C. Bernard

Journal of Nematology, Volume 50 , ISSUE 2, 133–146

Original Paper | 10-December-2018

Aspergillus penicillioides Speg. Implicated in Keratomycosis

of the following rDNA regions: ITS1, ITS2, 5.8S, 28S rDNA, LSU and β-tubulin were carried out for the isolates studied. A high level of similarity was found between sequences from certain rDNA regions, i.e. ITS1-5.8S-ITS2 and LSU, what confirmed the classification of the isolates to the species A. penicillioides. The classification of our isolates to A. penicillioides species was confirmed also by the phylogenetic analysis.

EULALIA MACHOWICZ-MATEJKO, AGNIESZKA FURMAŃCZYK, EWA DOROTA ZALEWSKA

Polish Journal of Microbiology, Volume 67 , ISSUE 4, 407–416

research-article | 24-April-2020

Cephalenchus driekieae n. sp. (Nematoda: Tylenchidae) from South Africa, a new member of the genus with a long pharyngeal overlap

, 20 km north of the town Lichtenburg (North-West Province, South Africa). In-depth investigations revealed that it belongs to an unknown species, being described herein as C. driekieae n. sp. Therefore, the present study aims to characterize this species using both traditional and molecular techniques and discuss its phylogenetic affinities using SSU and LSU markers. Materials and methods Nematode extraction and morphological studies Nematodes were extracted from the soil using the modified

Milad Rashidifard, Gerhard Du Preez, Joaquín Abolafia, Majid Pedram

Journal of Nematology, Volume 52 , 1–10

research-article | 18-March-2020

Description of Seinura italiensis n. sp. (Tylenchomorpha: Aphelenchoididae) found in the medium soil imported from Italy

(synthesized by Majorbio, Shanghai, China) were used in the PCR analyses to amplify the near full-length SSU and D2-D3 expansion segments of LSU rDNA. The SSU region was amplified as two partially overlapping fragments; for the first fragment, the forward 988F (5′-CTC AAA GAT TAA GCC ATG C-3′) and reverse 1912R (5′-TTT ACG GTC AGA ACT AGG G-3′) primers were used and for the second part, the forward 1813F (5′-CTG CGT GAG AGG TGA AAT-3′) and reverse 2646R (5′-GCT ACC TTG TTA CGA CTT TT-3′) primers were used

Jianfeng Gu, Munawar Maria, Lele Liu, Majid Pedram

Journal of Nematology, Volume 52 , 1–11

research-article | 13-April-2020

First molecular characterization of an Iranian population of Schistonchus caprifici (Gasparrini, 1864) Cobb, 1927 (Rhabditida; Aphelenchoidea)

population of the species. The two LSU fragments from two female specimens were amplified and sequenced to yield identically aligned 705 and 717 nt long sequences (GenBank accessions MN634962 and MN634963, respectively). Their BLAST search revealed they have 99.15 to 100% identity with the D2-D3 sequences of other isolates of the species deposited into GenBank. To reconstruct the LSU tree, several previously sequenced populations and the sequences generated by Gulcu et al. (2008) were selected. The two

Hadi Karimipour Fard, Hamid Zare

Journal of Nematology, Volume 52 , 1–3

research-article | 30-November-2018

The morphological characteristics and phylogenetic analysis of Pratylenchus vulnus Taiwan strawberry isolate

1000X magnification with compound microscope and SEM. Molecular analysis of the ribosomal RNA and mitochondrial gene sequences of the extracted nematodes confirmed their species as P. vulnus (Table 1). The rDNA LSU region (D2A/D3B: ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (Nunn, 1992), rDNA ITS region (TW81/AB28: GTTTCCGTAGGTGAACCTGC/ATATGCTTAAGTTCAGCGGGT) (Amiri et al., 2002; Subbotin et al., 2001), rDNA SSU region (SSU18A/SSU26R: AAAGATTAAGCCATGCATG/CATTCTTGGCAAATGCTTTCG) (Eyualem and

Yu-po Lin, Wan-chun Lee, Pei-che Chung, Jiue-in Yang

Journal of Nematology, Volume 51 , 1–5

Research Article | 17-October-2018

Description of Aphelenchoides giblindavisi n. sp. (Nematoda: Aphelenchoididae), and Proposal for a New Combination

morphometric data ranges. The morphological features and morphometrics of the second studied species, A. helicus, agreed well with the data given for the type population. However, detailed study of fresh females revealed it has three drop-shaped stylet knobs and long PUS, making it typologically similar to the genus Robustodorus, meriting its taxonomic revision, i.e., transferring to it. In molecular phylogenetic analyses using partial small and large subunit ribosomal RNA gene (SSU and LSU rDNA) sequences

Farzad Aliramaji, Ebrahim Pourjam, Sergio Álvarez-Ortega, Farahnaz Jahanshahi Afshar, Majid Pedram

Journal of Nematology, Volume 50 , ISSUE 3, 437–452

research-article | 11-March-2021

Morphological and molecular characters of Scutellonema brachyurus (Steiner, 1938) Andrássy, 1958 from South Africa

Ebrahim Shokoohi

journal of nematology, Volume 53 , 1–13

research-article | 25-May-2020

Morphological and molecular characterization of Ektaphelenchoides pini (Massey, 1966) Baujard, 1984 (Aphelenchoididae; Ektaphelenchinae) from Iran, with morphological and taxonomic observations on some species

´) (Dorris et al., 2002) and reverse primer 18S 1573R (5´-TACAAAGGGCAGGGACGTAAT-3´) (Mullin et al., 2005) (the several primers designed to amplify this fragment, e.g. two pairs designed by Holterman et al., 2006 did not yield on high-quality amplifications, or yield on no amplifications). The D2–D3 expansion segments of LSU rDNA were amplified using the forward D2A (5´-ACAAGTACCGTGAGGGAAAGT-3´) (Nunn, 1992) and reverse primer 1006R (5´-GTTCGATTAGTCTTTCGCCCCT-3´) (Holterman et al., 2008). The ITS1 region

Fariba Heydari, Majid Pedram

Journal of Nematology, Volume 52 , 1–12

research-article | 30-November-2020

An interesting rare tylenchid species, Antarctenchus urmiensis n. sp. (Tylenchomorpha; Psilenchidae) from Urmia Lake islands, northwest Iran, with a discussion on the taxonomy of related genera

forward primer 22F (5´–TCCAAGGAAGGCAGCAGGC–3´) and revers primer 13R (5´–GGGCATCACAGACCTGTTA–3´) (Dorris et al., 2002). Sometimes the reverse primer 1573 R (5´–TACAAAGGGCAGGGACGTAAT–3´) (Mullin et al., 2005) was used interchangeably. The LSU rDNA D2-D3 expansion segments were amplified using the forward D2A (5´–ACAAGTACCGTGAGGGAAAGTTG–3´) and reverse D3B (5’–TCGGAAGGAACCAGCTACTA–3´) (Nunn, 1992) primer pairs. The PCR products were sequenced in both directions using the same primers used in PCR with an

Mohammad Amiri Bonab, Joaquín Abolafia, Majid Pedram

Journal of Nematology, Volume 53 , 1–14

research-article | 03-June-2019

Morphological and molecular characterization of Labronema montanum sp. n. (Dorylaimida, Dorylaimidae) from Spain

R. Peña-Santiago, J. Abolafia

Journal of Nematology, Volume 51 , 1–11

research-article | 30-November-2018

First report of Longidorus mindanaoensis Coomans, De Ley, Jimenez and De Ley, 2012 (Nematoda: Longidoridae) From a Mangrove Forest in Vietnam

D2–D3 expansion segments of LSU rDNA were amplified using the primers D2A and D3B (5′-ACAAGTACCGTGGGGAAAGTTG-3′ and 5′-TCGGAAGGAACCAGCTACTA-3′) (De Ley et al., 1999). The newly obtained sequence was compared with previously submitted sequences into the GenBank database (Altschul et al., 1997) using BLAST search. Multiple alignments were made using MUSCLE and Modeltest was used to select the best fit model in MEGA 6 (Tamura et al., 2013). MrBayes 3.2.6 (Huelsenbeck and Ronquist, 2001) in Geneious

Thi Duyen Nguyen, Huu Tien Nguyen, Thi Mai Linh Le, Neriza Nobleza, Quang Phap Trinh

journal of nematology, Volume 51 , 1–5

Article | 24-July-2017

Discopersicus n. gen., a New Member of the Family Tylenchidae Örley, 1880 with Detailed SEM Study on Two Known Species of the Genus Discotylenchus Siddiqi, 1980 (Nematoda; Tylenchidae) from Iran

SEM study of the genus. These results confirmed longitudinal amphidial aperture type on lateral sides of the lip region in genus Discotylenchus, as noted by Siddiqi while erecting the genus with D. discretus as the type species. Molecular phylogenetic analyses using partial small subunit (SSU) and large subunit (LSU) rDNA sequences revealed the affinity of the genus Discopersicus n. gen. with members of the subfamily Boleodorinae, as supported by morphological characters (mainly, the oblique

ALI YAGHOUBI, EBRAHIM POURJAM, SERGIO A LVAREZ-ORTEGA, GRACIA LIE´BANAS, MOHAMMAD REZA ATIGHI, MAJID PEDRAM

Journal of Nematology, Volume 48 , ISSUE 3, 214–221

Article | 21-July-2017

Data on Some Species of the Genus Coslenchus Siddiqi, 1978 (Rhabditida, Tylenchidae) from Iran

YOUSEF PANAHANDEH, EBRAHIM POURJAM, MAJID PEDRAM

Journal of Nematology, Volume 48 , ISSUE 4, 268–279

research-article | 30-November-2020

Basilaphelenchus hyrcanus n. sp. (Rhabditida: Tylaphelenchinae) associated with bark of a beech tree (Fagus orientalis Lipsky) from northern Iran

and body shape and tail characters, as well by the SSU and LSU markers, and can be separated from the five previously described species by the longer stylet. The detailed comparisons are as follows: the new species can be distinguished from B. persicus by slightly longer body length of 383 (316–416) vs 352 (297–393) μm, c = 13 (11.5–14) vs 9.7 (8.3–11.8), longer stylet of 9.4 (9.0–10.0) vs 6.7 (5.5–7.5) μm, metacorpus shape (well developed, elongate, filling corresponding body region with

Behrouz Golhasan, Esmaeil Miraeiz, Zahra Tanha maafi, Ramin Heydari

Journal of Nematology, Volume 53 , 1–11

Article | 21-July-2017

Description of Aphelenchoides macrospica n. sp. (Nematoda:Aphelenchoididae) from Northwestern Iran

BEHROUZ GOLHASAN, RAMIN HEYDARI, MEHRAB ESMAEILI, ESMAEIL MIRAEIZ

Journal of Nematology, Volume 49 , ISSUE 1, 67–76

research-article | 30-November-2020

Morphological and molecular characterization of Bitylenchus hispaniensis (Nematoda: Telotylenchidae) from Iran

upon morphological and morphometric characteristics. Additionally, molecular data from LSU D2D3 and ITS rDNA markers were used to study the phylogenetic relationships with others Bitylenchus species. Materials and methods Nematode extraction and morphological observations Several soil samples were collected from the rhizosphere of euphrates poplar (Populus euphratica Oliv.) trees in Khuzestan province, Iran. Centrifugal – flotation technique (Jenkins, 1964) or the tray method (Whitehead and

Abbas Abdolkhani, Sedighe Azimi

Journal of Nematology, Volume 53 , 1–10

research-article | 28-April-2020

Morphological and molecular characterization of Pungentus sufiyanensis n. sp. and additional data on P. engadinensis (Altherr, 1950) Altherr, 1952 (Dorylaimida: Nordiidae) from northwest of Iran

Nasir Vazifeh, Gholamreza Niknam, Habibeh Jabbari, Reyes Peña-Santiago

Journal of Nematology, Volume 52 , 1–12

Article | 21-July-2017

New Cyst Nematode, Heterodera sojae n. sp. (Nematoda: Heteroderidae) from Soybean in Korea

–30 mm). It is distinguished from H. elachista by larger cyst (513.4–778.3 mm3 343.4–567.1 mm vs. 350–560 mm 3 250–450 mm) and longer stylet length of J2 (23.8–25.3 mm vs. 17–19 mm). Molecular analysis of rRNA large subunit (LSU) D2–D3 segments and ITS gene sequence shows that H. sojae n. sp. is more close to rice cyst nematode H. elachista than H. glycines. Heterodera sojae n. sp. was widely distributed in Korea. It was found from soybean

HEONIL KANG, GEUN EUN, JIHYE HA, YONGCHUL KIM, NAMSOOK PARK, DONGGEUN KIM, INSOO CHOI

Journal of Nematology, Volume 48 , ISSUE 4, 280–289

Article | 04-December-2017

Morphological and Molecular Characteristics of Pratylenchus haiduongensis sp. n., a New Species of Root–Lesion Nematodes Associated with Carrot in Vietnam

terminus observed in some specimens. The matrix code of P. haiduongensis sp. n. is: A2, B1, C4, D(1,3), E1, F(5,6), G(1,2), H(1,4); I(1,2,3,4), J1, K(1,2) according to Castillo and Vovlas (2007). The LSU–D2D3 segment and the ITS–rDNA region of this species were amplified and sequenced. The morphological characters and molecular phylogenetic analyses confirmed that this is a new species of the genus Pratylenchus in Vietnam.

THI DUYEN NGUYEN, THI MAI LINH LE, HUU TIEN NGUYEN, THI ANH DUONG NGUYEN, GRACIA LIEBANAS, QUANG PHAP TRINH

Journal of Nematology, Volume 49 , ISSUE 3, 276–285

research-article | 30-November-2018

Molecular and morphological characterization of Paurodontella composticola n. sp. (Nematoda: Hexatylina, Sphaerulariidae) from Iran

* version 4.0 (Sinauer Associates, Inc. Publishers, Sunderland, MA). Table 1. Species used for the analysis of phylogenetic relationships and the accession numbers for LSU sequences deposited in GenBank Species. Accession number Authors Species Accession number Authors Abursanema iranicum KF885742 Yaghoubi et al. (2014) Howardulla sp. JX291131 Chizhov et al. (2012) Anguina sp. KU317615 unpublished data Litylenchus coprosma GU727547 Zhao et al. (2012) Anguina tritici

Mehrab Esmaeili, Ramin Heydari, Ahmad Kheiri, Weimin Ye

Journal of Nematology, Volume 51 , 1–12

research-article | 26-March-2021

Morphological and molecular characterization of Butlerius butleri Goodey, 1929 (Nematoda: Diplogastridae) from South Africa: First report

, the tubes were vortexed (15 sec) and centrifuged at 8,000 rpm for 10 sec. Finally, the tubes were incubated at 56°C for 2 hr followed by incubation at 95°C for 10 min before they were stored at −20°C. The following DNA markers were used to amplify the small and large sub units (SSU and LSU) genes, respectively: SSU F04 (5′-GCTTGTCTCAAAGATTAAGCC-3′), SSU R26 (5′-CATTCTTGGCAAATGCTTTCG-3′) (Blaxter et al., 1998), and D2A (5′-ACAAGTACCGTGAGGGAAAGTTG-3′), D3B (5′-TCGGAAGGAACCAGCTACTA-3′) (Subbotin et

Chantelle Girgan, Gerhard Du Preez, Hendrika Fourie, Milad Rashidifard

Journal of Nematology, Volume 53 , 1–12

research-article | 30-November-2018

Cryphodera gayae n. sp. (Nematoda: Heteroderidae), from root of Lagerstroemia indica in Korea

) and observed under a scanning electron microscope (Jeol JSM-6390) at 10 kV. Molecular study For molecular analysis, DNA was extracted with DNeasy Blood and Tissue Kit (Qiagen Inc., Valencia, CA). Two rRNA fragments, i.e. the LSU D2–D3 and ITS regions, were amplified. Primers for D2–D3 segments amplification were D2A (5′-ACAAGTACCGTGAGGGAAAGTTG-3′) and D3B (5′-TCGGAAGGAACCAGCTACTA-3′). Primers for ITS amplification were TW81 (5′-GTTTCCGTAGGTGAACCTGC-3′) and AB28 (5′-ATATGCTTAAGTTCAGCGGGT-3

Heonil Kang, Jongmin Seo, Garam Han, Donggeun Kim, Insoo Choi

Journal of Nematology, Volume 51 , 1–12

research-article | 01-April-2021

First record of Oscheius myriophilus (Poinar, 1986) (Rhabditida: Rhabditidae) from Iran; and its efficacy against two economic forest trees pests, Cydalima perspectalis (Walker, 1859) (Lepidoptera: Crambidae) and Hyphantria cunea (Drury, 1773) (Lepidoptera: Erebidae) in laboratory condition

(Fadakar et al., 2020). Three DNA samples were prepared in this way. The DNA samples were stored at −20°C until used in polymerase chain reaction (PCR). The PCR to amplify the partial SSU and D2-D3 expansion segments of LSU rDNA was carried out in a total volume of 35 μl (12.1 μl distilled water, 17.5 μl Taq 2X PCR Master Mix, AMPLIQON, Denmark, 1.2 μl of each primers and 3 μl DNA template). The partial SSU rDNA was amplified using the forward primer F22 (5’–TCCAA GGAAGGCAGCAGGC–3’) (Dorris et al

Reihaneh Gholami Ghavamabad, Ali Asghar Talebi, Mohammad Mehrabadi, Mohammad Ebrahim Farashiani, Majid Pedram

Journal of Nematology, Volume 53 , 1–16

No Record Found..
Page Actions