Research paper | 01-June-2011
In this paper, composition analysis using scanning electron microscopy/energy-dispersive X-ray spectroscopy analysis (SEM-EDX) and laser-induced breakdown spectroscopy (LIBS) for particulate matter in diesel exhaust is presented. Conventionally, scanning mobility particle sizer (SMPS) has been widely used to obtain particle size distribution of the suspended particles. However, real-time analysis of the composition of diesel particulate matter is difficult because of the small sized particles
S. Ikezawa,
M. Wakamatsu,
T. Ueda
International Journal on Smart Sensing and Intelligent Systems, Volume 4 , ISSUE 2, 174–188
Article | 24-July-2017
Discopersicus iranicus n. gen., n. comb., previously described from Iran as a new species under the genus Discotylenchus, is illustrated using light microscope and scanning electron microscope (SEM) observations and further studied using molecular characters. SEM studies revealed the newly proposed genus has oblique amphidial apertures on the lateral sides of the lip region. SEM images are also provided for two species of Discotylenchus, namely D. discretus and D. brevicaudatus, as the first
ALI YAGHOUBI,
EBRAHIM POURJAM,
SERGIO A LVAREZ-ORTEGA,
GRACIA LIE´BANAS,
MOHAMMAD REZA ATIGHI,
MAJID PEDRAM
Journal of Nematology, Volume 48 , ISSUE 3, 214–221
Research Article | 27-December-2017
Semiconductive nanometer-size material ZnCo2O4 was synthesized by a solution combustion reaction of inorganic reagents of Zn(NO3)3. 6H2O, Co(NO3)3.6H2O and glycine as a fuel. The process was a convenient, environment friendly, inexpensive and efficient preparation method for the ZnCo2O4 nanomaterial. The synthesized materials were characterized by TG/DTA, XRD, EDX, SEM, and TEM. Conductance responses of the nanocrystalline ZnCo2O4 thick film were measured by exposing the film to reducing gases
S. V. Bangale
International Journal on Smart Sensing and Intelligent Systems, Volume 7 , ISSUE 1, 178–195
research-article | 03-June-2019
80i (Nikon, Tokio, Japan) microscope with differential interference contrast (DIC) optics, a drawing tube (camera lucida) and a Nikon Digital Sight DS-U1 camera. Photographs were edited using Adobe® Photoshop® CS software.
Scanning electron microscopy (SEM)
Specimens preserved in glycerine were selected for observation under SEM according to Abolafia (2015). They were hydrated in distilled water, dehydrated in a graded ethanol–acetone series, critical point dried, coated with gold, and observed
R. Peña-Santiago,
J. Abolafia
Journal of Nematology, Volume 51 , 1–11
Article | 21-July-2017
, and male absent. Scanning electron microscope (SEM) study, the first of a representative of the genus, shows a lip region pattern significantly different from that observed in the typical aporcelaimid taxa.
THI ANH DUONG NGUYEN,
JOAQUI´N ABOLAFIA,
MICHAEL BONKOWSKI,
REYES PEN A–SANTIAGO
Journal of Nematology, Volume 48 , ISSUE 2, 104–108
Original Paper | 28-June-2017
An Egyptian, plant pathogenic Fusarium solani isolate was grown on cobalt concentrations of 0, 50, 200, 500, 800, and 1000 ppm. The isolate survived concentrations up to 800 ppm, however failed to grow at 1000 ppm. Morphology and elemental analysis of the isolate under the investigated Co concentrations were studied using Scanning electron microscopy (SEM) and energy dispersive X-ray microanalysis (EDX). The isolate reserved its morphology up to a concentration of 200 ppm. Morphological
Farrag M. Rasha
Polish Journal of Microbiology, Volume 66 , ISSUE 2, 235–243
Article | 21-July-2017
Sectonema caobangense sp. n. from evergreen forest soil in Vietnam is described, including scanning electron micrograph (SEM) observations and D2-D3 LSU rDNA analysis. The new species is characterized by its 3.12 to 5.80mmlong body, lip region offset by deep constriction and 21 to 23 mm broad, mural tooth 13 to 14 mm long at its ventral side, 940 to 1,112 mm long neck, pharyngeal expansion occupying 61% to 69% of total neck length, uterus a long simple tube-like structure 292 to 363
SERGIO ALVAREZ-ORTEGA,
THI ANH DUONG NGUYEN,
JOAQUI´N ABOLAFIA,
MICHAEL BONKOWSKI,
REYES PEN˜A-SANTIAGO
Journal of Nematology, Volume 48 , ISSUE 2, 95–103
research-article | 30-November-2018
De Ley et al. (1995) and Abolafia and Peña-Santiago (2017), respectively.
Scanning Electron Microscopy (SEM)
Specimens preserved in glycerine were selected for observation under SEM according to Abolafia (2015). They were hydrated in distilled water, dehydrated in a graded ethanol-acetone series, critical point dried, coated with gold, and observed with a Zeiss Merlin microscope (5 kV) (Zeiss, Oberkochen, Germany).
DNA Extraction, PCR and Sequencing
Nematode DNA was extracted from single
Joaquín Abolafia,
Reyes Peña-Santiago
journal of nematology, Volume 51 , 1–21
Research Article | 17-October-2018
One new and one known species of the genus Aphelenchoides from Iran are studied. Aphelenchoides giblindavisi n. sp. is mainly characterized by having five lines in the lateral fields at mid-body, and a single mucro with several tiny nodular protuberances, giving a warty appearance to it, as revealed by detailed scanning electron microscopic (SEM) studies. The new species is further characterized by having a body length of 546 to 795 μm in females and 523 to 679 μm in males, rounded lip region
Farzad Aliramaji,
Ebrahim Pourjam,
Sergio Álvarez-Ortega,
Farahnaz Jahanshahi Afshar,
Majid Pedram
Journal of Nematology, Volume 50 , ISSUE 3, 437–452
Research Article | 15-February-2020
NTC thermistors of Y-Al-Mn-Fe-Ni-Cr-O systems were fabricated by using normal ceramic processing for wide temperature range measurement. Pt-Rh alloy as electrodes was inserted into the body during the forming process to increase the reliability of high temperature and to decrease the contact resistance. The properties were analyzed by XRD, SEM and resistance measurement. There are no distinct XRD patterns between Y0.2Al0.1Mn0.27Fe0.16Ni0.27Ox and Y0.2Al0.1Mn0.264Fe0.16 Ni0.264Cr0.012Ox because
Woonyoung Lee,
Jinseong Park
International Journal on Smart Sensing and Intelligent Systems, Volume 7 , ISSUE 5, 1–4
Article | 14-October-2020
distance of 20 cm and a flowrate of 7.2 µl/mine.
B.
Scanning Electron Microscopy (SEM)
A Zeiss Auriga Focused ION FE SEM (Oberkochen, Germany). All materials were coated with gold nanoparticles for one minute using a Leica EM MED020 (Wetzlar, Germany) under vacuum. Analysis was carried out at 2.00 kV EHT, and estimation of the dimensions of the fibers was performed using ImageJ and DiameterJ.
C.
Rheological Properties
Prepared mixture was loaded between two 50mm-diameter parallel plates with a gap
Haifa El-sadi,
Shady Sally,
Alex Bossart,
Dilhan Kalyon
International Journal of Advanced Network, Monitoring and Controls, Volume 5 , ISSUE 3, 9–15
research-article | 30-November-2018
et al., 2008, 2009; Van den Berg et al., 2014) have been successfully utilized in pin nematode taxonomy. Recently, several new and known species of nematodes were described based on combined morphological, molecular, and SEM observation (Maria et al., 2018b; Zhuo et al., 2018). Moreover, DNA studies have significant advantages to precisely identify morphologically similar species, such as cryptic species. In an attempt to document the ectoparasitic nematodes from Zhejiang Province, China, two
Munawar Maria,
Wentao Miao,
Weimin Ye,
Jingwu Zheng
journal of nematology, Volume 51 , 1–13
research-article | 30-November-2019
infected roots.
Specimens were prepared for scanning electron microscopy (SEM) by sequential fixation and freeze-drying (Eisenback, 1987). Stylets were extracted in 45% lactic acid as previously described (Eisenback et al., 1980). Perineal patterns were made as described by Hartman and Sasser (1985) and observed according to Eisenback (2010). Whole specimens prepared for light microscopy (LM) were mounted on 4% water agar blocks (Eisenback, 2012). They were photographed with a Nikon D300 DSLR camera
J. D. Eisenback,
P. Vieira
Journal of Nematology, Volume 52 , 1–13
Research Article | 13-December-2017
ridge structure. Structural characterization of the fabricated structures were investigated using optical microscope and SEM.
P.K. Dey,
B. Pramanick,
A. RaviShankar,
P. Ganguly,
S. Das
International Journal on Smart Sensing and Intelligent Systems, Volume 3 , ISSUE 1, 118–129
research-article | 18-March-2020
= 0.70). The latter was used to measure repressive emotion in the present study.
Analyses
The proposed model was analyzed by the structural equation modeling (SEM) in LISREL 8.71. Before the analysis, the data were examined for the assumptions of SEM. The two-stage approach in which the measurement and the structural models are tested separately was preferred in SEM (76). Sample size, missing values, outliers, multicollinearity, linearity and homoscedasticity assumptions were met. Since the data
Gülendam Akgül,
Müge Artar
Scandinavian Journal of Child and Adolescent Psychiatry and Psychology, Volume 8 , 25–37
Article | 01-June-2012
short response time and large recovery time. Physical and structural properties of the film material were studied by SEM, TEM, XRD and UV spectroscopy.
N. K. Pawar,
D. D. Kajale,
G. E. Patil,
V. G. Wagh,
V. B. Gaikwad,
M. K. Deore,
G. H. Jain
International Journal on Smart Sensing and Intelligent Systems, Volume 5 , ISSUE 2, 441–457
Original Research | 11-December-2017
Jiyeon Kim,
Taeho Kim,
Joong-Ki Park
Journal of Nematology, Volume 49 , ISSUE 2, 162–167
Article | 01-September-2012
Nanocrystalline sensors having the general formula ZnO + x wt% CeO2, where x = 0, 2, 4 and 6 were prepared by chemical precipitation method and sintered at 400, 600 and 800 oC for 2h in static air atmosphere. The crystal structure and the morphology of the prepared samples were investigated and characterized by using XRD, IR, SEM and TEM techniques. The investigation revealed that the average crystallites size increases with increasing the sintering temperature. The electrical conductivity is
A. M. El-Sayed,
F. M. Ismail,
M. H. Khder,
M. E. M. Hassouna,
S. M. Yakout
International Journal on Smart Sensing and Intelligent Systems, Volume 5 , ISSUE 3, 606–623
Article | 01-September-2012
Nanocrystalline ZrO2 (Zirconia) has been synthesized by a conventional precipitation method. The structural, morphological, microstructural, optical and gas-sensing properties of ZrO2 were investigated by using X-ray diffraction analysis (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), UV-vis spectroscopy and static gas sensing unit, respectively. X-ray diffraction pattern and TEM of the synthesized product reveal their nano-crystalline nature with grain size
Pratap G. Patil,
D. D. Kajale,
V. P. Patil,
G. E. Patil,
G. H. Jain
International Journal on Smart Sensing and Intelligent Systems, Volume 5 , ISSUE 3, 673–684
Original Paper | 26-August-2016
g/l n-hexadecane (40 cycles). The alkanotrophic strain R. wratislawiensis BN38 preferably degraded hexadecane rather than phenol. SEM revealed well preserved cells entrapped in the heterogeneous super-macroporous structure of the cryogel which allowed unhindered mass transfer of xenobiotics. The immobilized strain can be used in real conditions for the treatment of contaminated industrial waste water
Alexander E. Hristov,
Nelly E. Christova,
Lyudmila V. Kabaivanova,
Lilyana V. Nacheva,
Ivanka B. Stoineva,
Petar D. Petrov
Polish Journal of Microbiology, Volume 65 , ISSUE 3, 287–293
research-article | 30-November-2019
microstructure, morphology, film thickness and composition using the methods, namely, X-ray diffraction (XRD), scanning electron microscopy (SEM), energy-dispersive spectroscopy (EDS), etc. X-ray diffraction studies (XRD, Bruker D8 Advance Diffractometer, Model No: A18-A100/D76182) with Nickel filtered Cu Kα radiation, λ = 0.15406 nm, in the 2θ range 20o to 90o were conducted to evaluate the structural properties. Surface morphology and cross-section of the thin films were analyzed using field emission
Suma M. N.,
Venkateswarlu Gaddam,
M. V. N. Prasad,
M. M. Nayak,
K. Rajanna
International Journal on Smart Sensing and Intelligent Systems, Volume 13 , ISSUE 1, 1–9
Article | 01-March-2012
ZnO nanorods with different sizes and shapes have been successfully synthesized via a simple hydrothermal route, using zinc acetate and Cetyltriammonium bromide (CTAB) as the reactants. The thick films of as prepared ZnO were prepared by screen-printing technique in desired pattern. The films are characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM) and transmission electron microscopy (TEM). The gas sensing properties of the materials have been investigated for various
Sarika D. Shinde,
G. E. Patil,
D. D. Kajale,
D. V. Ahire,
V. B. Gaikwad,
G. H. Jain
International Journal on Smart Sensing and Intelligent Systems, Volume 5 , ISSUE 1, 57–70
Research paper | 13-December-2017
M. Shafiei,
K. Kalantar-zadeh,
W. Wlodarski,
E. Comini,
M. Ferroni,
G. Sberveglieri,
S. Kaciulis,
L. Pandolfi
International Journal on Smart Sensing and Intelligent Systems, Volume 1 , ISSUE 3, 771–783
research-article | 30-November-2018
1000X magnification with compound microscope and SEM.
Molecular analysis of the ribosomal RNA and mitochondrial gene sequences of the extracted nematodes confirmed their species as P. vulnus (Table 1). The rDNA LSU region (D2A/D3B: ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (Nunn, 1992), rDNA ITS region (TW81/AB28: GTTTCCGTAGGTGAACCTGC/ATATGCTTAAGTTCAGCGGGT) (Amiri et al., 2002; Subbotin et al., 2001), rDNA SSU region (SSU18A/SSU26R: AAAGATTAAGCCATGCATG/CATTCTTGGCAAATGCTTTCG) (Eyualem and
Yu-po Lin,
Wan-chun Lee,
Pei-che Chung,
Jiue-in Yang
Journal of Nematology, Volume 51 , 1–5
Article | 04-December-2017
THI DUYEN NGUYEN,
THI MAI LINH LE,
HUU TIEN NGUYEN,
THI ANH DUONG NGUYEN,
GRACIA LIEBANAS,
QUANG PHAP TRINH
Journal of Nematology, Volume 49 , ISSUE 3, 276–285
Research Article | 15-February-2020
J. A. Luna López,
A. Benítez Lara,
G. García Salgado,
D. Hernández de la Luz,
M. Pacio,
A. Morales Sanchez,
S. A. Perez Garcia
International Journal on Smart Sensing and Intelligent Systems, Volume 7 , ISSUE 5, 1–6
Article | 01-March-2012
images show nano-particles as clusters with size in the range of 10-20 nm. Electron diffraction pattern of nano-powders annealed at 900oC temperature shows a well distribution of spherical particles due to the effect of citric acid as surfactant in chemical process. Thick films prepared by screen printing technique from zinc oxide nano-powders annealed at different temperatures (500–900 oC), characterized by SEM analysis and tested for various gases. The film prepared from ZnO powder annealed
Sarika D. Shinde,
G. E. Patil,
D. D. Kajale,
V. G. Wagh,
V. B. Gaikwad,
G. H. Jain
International Journal on Smart Sensing and Intelligent Systems, Volume 5 , ISSUE 1, 277–294
Research paper | 13-December-2017
Subha Chakraborty,
A. Bhattacharya,
Ashesh Ray Chaudhuri,
T.K. Bhattacharyya
International Journal on Smart Sensing and Intelligent Systems, Volume 3 , ISSUE 1, 94–107
research-article | 30-November-2019
microscopy (SEM)
Specimens preserved in glycerine were selected for observation under SEM according to the methods of Abolafia (2015). They were hydrated in distilled water, dehydrated in a graded ethanol-acetone series, critical point dried, coated with gold, and observed with a Zeiss Merlin microscope (5 kV) (Zeiss, Oberkochen, Germany).
Phylogenetic analyses
For phylogenetic relationships, analyses were based on 18S and 28S rDNA gene sequences available in GenBank. The sequences were aligned using
Joaquín Abolafia,
Reyes Peña-Santiago
Journal of Nematology, Volume 52 , 1–20
original-paper | 05-December-2019
/qt, respectively.
Scanning Electron Microscopy (SEM) and Energy Dispersive X-ray spectrometry (EDX) analysis. Morphology and elemental composition of biosorbent before and after biosorption with Fe(II) ions were examined by the Field Emission Scanning Electron Microscope (FE-SEM) (CARL ZEISS SUPRA 55 GEMIN-German Technology Jena, Germany). Biomass samples were glutaraldehyde fixed, attached to 10 mm alumina-based mounts and sputtered with gold particles by using sputter coater (SC7620 ‘Mini
SRI LAKSHMI RAMYA KRISHNA KANAMARLAPUDI,
SUDHAMANI MUDDADA
Polish Journal of Microbiology, Volume 68 , ISSUE 4, 549–558
research-article | 24-April-2020
as template to redraw in CorelDRAW® software version 2018.
Scanning electron microscopy (SEM)
For SEM, the nematodes mounted on permanent slides were cleaned and hydrated in distilled water, dehydrated in a graded ethanol-acetone series, critical point dried, coated with gold, and observed with a Zeiss Merlin microscope (5 kV) (Zeiss, Oberkochen, Germany) (Abolafia, 2015).
DNA extraction, PCR reaction, and gel electrophoresis
DNA extraction and PCR conditions followed Rashidifard et al. (2019
Milad Rashidifard,
Gerhard Du Preez,
Joaquín Abolafia,
Majid Pedram
Journal of Nematology, Volume 52 , 1–10
Short Communication | 28-June-2017
Beata Zimowska,
Ewa Dorota Zalewska,
Ewa Dorota Król,
Agnieszka Furmańczyk
Polish Journal of Microbiology, Volume 66 , ISSUE 2, 281–285
Article | 01-September-2012
Thick film technique is popular because of low cost, simple for construction and better sensing surface area, hence for resistive gas sensor thick films of pure ZrO2 powder were prepared by Standard screen printing technique. The material was characterized by X-Ray diffraction pattern, surface morphology was observed by SEM, elemental composition were observed by EDAX and optical properties were studied with UV spectroscopy Techniques, electrical properties were studying with different applied
S. B. Deshmukh,
R. H. Bari,
G. E. Patil,
D. D. Kajale,
G. H. Jain,
L. A. Patil
International Journal on Smart Sensing and Intelligent Systems, Volume 5 , ISSUE 3, 540–558
Research Article | 27-December-2017
for gas concentration of 50 ppm with film dipped for 10 min. time interval. The characterization of the films was done by XRD, SEM and TG-DTA. Crystallite size, texture coefficient, specific surface area, electric properties and gas sensitivity of the films were measured and presented.
N.U. PATIL,
V.B. GAIKWAD,
P.D. HIRE,
R.M. CHAUDHARI,
M. K. DEORE,
G. H. JAIN
International Journal on Smart Sensing and Intelligent Systems, Volume 6 , ISSUE 1, 433–447
research-article | 07-January-2020
procedure [26], density test – in accordance with EN 12350-6:2000 [27], air content – the pressure method according to EN 12350-7:2001 [28].
The compressive strength of concrete was investigated according to EN 12390-3 [30]. The microstructure and porosity of hardened concrete P1, P2, P1A6b, after 28 days curing in water, were investigated using the following methods: porosity structure parameters are investi-gated according to PN-EN 480-11 [29], the microstructure of concrete according to SEM (Scanning
Beata ŁAŹNIEWSKA-PIEKARCZYK
Architecture, Civil Engineering, Environment, Volume 12 , ISSUE 4, 61–71
research-article | 30-November-2018
.
Scanning electron microscopy (SEM)
Specimens preserved in glycerine were selected for observation under SEM according to Abolafia (2015). The nematodes were hydrated in distilled water, dehydrated in a graded ethanol-acetone series, critical point dried, coated with gold, and observed with a Zeiss Merlin microscope (5 kV) (Zeiss, Oberkochen, Germany).
Statistical analysis
Principal component analysis and the correlation of morphometric data using the Pearson method was done by XLSTAT (Addinsoft, 2007
Ebrahim Shokoohi,
Joaquín Abolafia,
Phatu William Mashela,
Nafiseh Divsalar
Journal of Nematology, Volume 51 , 1–26
Research Article | 15-February-2020
this case for multilayer as-growth, and subsequently a dry oxidation was performed to observe the change in refractive index and reflectance. A model that contains the refractive index of silicon, air and silicon oxide is used for predicting the behavior of the reflectance spectra. With this model is possible to control the width of the reflectance spectrum of the band pass or also called Distributed Bragg Reflector (DBR), DBR were characterized and measured by SEM and UV-VIS spectroscopy
F. Morales Morales,
G. García Salgado,
J. A. Luna López,
T. Díaz,
E. Rosendo,
H. Juárez,
K. Monfil Leyva,
D. Hernández de la Luz
International Journal on Smart Sensing and Intelligent Systems, Volume 7 , ISSUE 5, 1–6
Research Article | 31-May-2018
mitochondrial cytochrome oxidase subunit 1 (CoxI) genes revealed this as Oscheius onirici, a species recently described from a karst cave soil of central Italy. The species belongs to the dolichura-group and is characterized by its DNA sequences; hermaphroditic reproduction; and males not found. A Bacillus-like bacterium appears to be associated with this nematode based on our microscopic and SEM observations; however its identity and persistent association with the nematode has not been confirmed
Weimin Ye,
Shane Foye,
Ann E. MacGuidwin,
Shawn Steffan
Journal of Nematology, Volume 50 , ISSUE 1, 9–26
Article | 21-July-2017
GARY PHILLIPS,
ERNEST C. BERNARD,
ROBERT J. PIVAR,
JOHN K. MOULTON,
ROWLAND M. SHELLEY
Journal of Nematology, Volume 48 , ISSUE 3, 159–169
research-article | 27-May-2019
using the ZEN lite software on ZEISS Axiocam ERc5s digital camera. Raw photographs were edited with Adobe Illustrator CS 3.
Scanning electron microscopy (SEM)
After examination and identification, good specimens were selected for SEM imaging, following the protocol of Abolafia (2015). The nematodes were hydrated in distilled water, dehydrated in a graded ethanol and acetone series, critical point dried, coated with gold, and observed with a Zeiss Merlin Scanning Electron Microscope.
Molecular
Huu Tien Nguyen,
Thi Mai Linh Le,
Thi Duyen Nguyen,
Gracia Liebanas,
Thi Anh Duong Nguyen,
Quang Phap Trinh
Journal of Nematology, Volume 51 , 1–12
research-article | 16-April-2020
possesses unique characters and needs to be considered as a new member of the genus. Therefore, this study describes a new Geocenamus species with the following objectives: to provide an integrative morphological and molecular characterization of the new species; to elucidate important morphological details through SEM observations; and to study the phylogenetic relationships of these species with other merlinid and related nematodes.
Materials and methods
Nematode extraction and morphological study
Munawar Maria,
Wentao Miao,
Pablo Castillo,
Jingwu Zheng
Journal of Nematology, Volume 52 , 1–13
research-article | 22-February-2021
Kenya. The potential importance of this nematode as a pest of finger millet was evidenced by its dense population in the soil sample and its presence observed in the finger millet root system (revealed by the fuchsin staining method). Nematode characterization was carried out based on morphological information obtained from light microscopy (LM) and scanning electron microscopy (SEM) studies. Illustrations, morphometrics, and molecular information of ITS, 18S, and 28S of rDNA and COI of mtDNA are
Phougeishangbam Rolish Singh,
Gerrit Karssen,
Kelvin Gitau,
Cecilia Wanjau,
Marjolein Couvreur,
Njira Njira Pili,
Godelieve Gheysen,
Wim Bert
Journal of Nematology, Volume 53 , 1–14
research-article | 30-November-2018
Pingelly with typical P. curvicauda features were fixed in 4% formaldehyde solution and sent to an expert taxonomist in the UK for further characterization. The detailed morphometric measurements obtained were compared with those taken in Australia.
Preparation of nematode samples for scanning electron microscopy
Scanning electron microscopy (SEM) was used to further characterize P. curvicauda. To do this, single nematodes were fixed in 3% glutaraldehyde in 0.025 M phosphate buffer (pH 7.0) overnight
Farhana Begum,
John Fosu-Nyarko,
Shashi Sharma,
Bill Macleod,
Sarah Collins,
Michael G. K. Jones
Journal of Nematology, Volume 51 , 1–15