Search

  • Select Article Type
  • Abstract Supplements
  • Blood Group Review
  • Call to Arms
  • Hypothesis
  • In Memoriam
  • Interview
  • Introduction
  • Short Report
  • abstract
  • Abstracts
  • Article
  • book-review
  • case-report
  • case-study
  • Clinical Practice
  • Commentary
  • Conference Presentation
  • conference-report
  • congress-report
  • Correction
  • Editorial
  • Editorial Comment
  • Erratum
  • Events
  • Letter
  • Letter to Editor
  • mini-review
  • minireview
  • News
  • Obituary
  • original-paper
  • Original Research
  • Pictorial Review
  • Position Paper
  • Practice Report
  • Preface
  • Preliminary report
  • Product Review
  • rapid-communication
  • Report
  • research-article
  • Research Communicate
  • research-paper
  • Research Report
  • Review
  • review -article
  • review-article
  • Review Paper
  • Sampling Methods
  • Scientific Commentary
  • short-communication
  • Student Essay
  • Varia
  • Welome
  • Select Journal
  • Polish Journal Of Microbiology
  • In Jour Smart Sensing And Intelligent Systems
  • Journal Of Nematology
  • Sj Child Adolescent Psychiatry Psychology
  • Architecture Civil Engineering Environment

 

Original Paper

Screening and Identification of Trichoderma Strains Isolated from Natural Habitats with Potential to Cellulose and Xylan Degrading Enzymes Production

useful for lignocellulose biomass conversion e.g. for biofuel production.

ROMAN MARECIK, LIDIA BŁASZCZYK, RÓŻA BIEGAŃSKA-MARECIK, AGNIESZKA PIOTROWSKA-CYPLIK

Polish Journal of Microbiology , ISSUE 2, –

original-paper

Direct Fermentative Hydrogen Production from Cellulose and Starch with Mesophilic Bacterial Consortia

pretreatment was found the most effective during hydrogen production from xylose (Mockaitis et al. 2020). On the other hand, Yang et al. (2019) showed that the highest hydrogen yield from antibiotic fermentation residue was obtained with alkaline treatment. Therefore, it is necessary to analyze inoculum pretreatment methods for more complex substrates. Due to the complex structure of lignocellulose biomass most reports in literature concern application of its hydrolysates for hydrogen production (Kumar et

ROMAN ZAGRODNIK, KRYSTYNA SEIFERT

Polish Journal of Microbiology , ISSUE 1, 109–120

Research paper

DIESEL PARTICULATE ANALYSIS USING SEM-EDX AND LASER-INDUCED BREAKDOWN SPECTROSCOPY

In this paper, composition analysis using scanning electron microscopy/energy-dispersive X-ray spectroscopy analysis (SEM-EDX) and laser-induced breakdown spectroscopy (LIBS) for particulate matter in diesel exhaust is presented. Conventionally, scanning mobility particle sizer (SMPS) has been widely used to obtain particle size distribution of the suspended particles. However, real-time analysis of the composition of diesel particulate matter is difficult because of the small sized particles

S. Ikezawa, M. Wakamatsu, T. Ueda

International Journal on Smart Sensing and Intelligent Systems , ISSUE 2, 174–188

Article

Discopersicus n. gen., a New Member of the Family Tylenchidae Örley, 1880 with Detailed SEM Study on Two Known Species of the Genus Discotylenchus Siddiqi, 1980 (Nematoda; Tylenchidae) from Iran

Discopersicus iranicus n. gen., n. comb., previously described from Iran as a new species under the genus Discotylenchus, is illustrated using light microscope and scanning electron microscope (SEM) observations and further studied using molecular characters. SEM studies revealed the newly proposed genus has oblique amphidial apertures on the lateral sides of the lip region. SEM images are also provided for two species of Discotylenchus, namely D. discretus and D. brevicaudatus, as the first

ALI YAGHOUBI, EBRAHIM POURJAM, SERGIO A LVAREZ-ORTEGA, GRACIA LIE´BANAS, MOHAMMAD REZA ATIGHI, MAJID PEDRAM

Journal of Nematology , ISSUE 3, 214–221

Research Article

NANOSTRUCTURED ZnCo2O4THICK FILM AS AN ETHANOL SENSOR

Semiconductive nanometer-size material ZnCo2O4 was synthesized by a solution combustion reaction of inorganic reagents of Zn(NO3)3. 6H2O, Co(NO3)3.6H2O and glycine as a fuel. The process was a convenient, environment friendly, inexpensive and efficient preparation method for the ZnCo2O4 nanomaterial. The synthesized materials were characterized by TG/DTA, XRD, EDX, SEM, and TEM. Conductance responses of the nanocrystalline ZnCo2O4 thick film were measured by exposing the film to reducing gases

S. V. Bangale

International Journal on Smart Sensing and Intelligent Systems , ISSUE 1, 178–195

research-article

Morphological and molecular characterization of Labronema montanum sp. n. (Dorylaimida, Dorylaimidae) from Spain

80i (Nikon, Tokio, Japan) microscope with differential interference contrast (DIC) optics, a drawing tube (camera lucida) and a Nikon Digital Sight DS-U1 camera. Photographs were edited using Adobe® Photoshop® CS software. Scanning electron microscopy (SEM) Specimens preserved in glycerine were selected for observation under SEM according to Abolafia (2015). They were hydrated in distilled water, dehydrated in a graded ethanol–acetone series, critical point dried, coated with gold, and observed

R. Peña-Santiago, J. Abolafia

Journal of Nematology , 1–11

Article

A Third New Species of Aporcelinus Andrassy, 2009 (Dorylaimida, Aporcelaimidae) from Vietnam, with the First SEM Study of a Representative of the Genus

, and male absent. Scanning electron microscope (SEM) study, the first of a representative of the genus, shows a lip region pattern significantly different from that observed in the typical aporcelaimid taxa.

THI ANH DUONG NGUYEN, JOAQUI´N ABOLAFIA, MICHAEL BONKOWSKI, REYES PEN A–SANTIAGO

Journal of Nematology , ISSUE 2, 104–108

Article

Sectonema caobangense sp. n. from Vietnam (Nematoda, Dorylaimida, Aporcelaimidae)

Sectonema caobangense sp. n. from evergreen forest soil in Vietnam is described, including scanning electron micrograph (SEM) observations and D2-D3 LSU rDNA analysis. The new species is characterized by its 3.12 to 5.80mmlong body, lip region offset by deep constriction and 21 to 23 mm broad, mural tooth 13 to 14 mm long at its ventral side, 940 to 1,112 mm long neck, pharyngeal expansion occupying 61% to 69% of total neck length, uterus a long simple tube-like structure 292 to 363

SERGIO ALVAREZ-ORTEGA, THI ANH DUONG NGUYEN, JOAQUI´N ABOLAFIA, MICHAEL BONKOWSKI, REYES PEN˜A-SANTIAGO

Journal of Nematology , ISSUE 2, 95–103

Original Paper

Intracellular Siderophore Detection in an Egyptian, Cobalt-Treated F. solani Isolate Using SEM-EDX with Reference to its Tolerance

An Egyptian, plant pathogenic Fusarium solani isolate was grown on cobalt concentrations of 0, 50, 200, 500, 800, and 1000 ppm. The iso­late survived concentrations up to 800 ppm, however failed to grow at 1000 ppm. Morphology and elemental analysis of the isolate under the investigated Co concentrations were studied using Scanning electron microscopy (SEM) and energy dispersive X-ray microanalysis (EDX). The isolate reserved its morphology up to a concentration of 200 ppm. Morphological

Farrag M. Rasha

Polish Journal of Microbiology , ISSUE 2, 235–243

research-article

Morphological and Molecular Characterization of Oscheius saproxylicus sp. n. (Rhabditida, Rhabditidae) From Decaying Wood in Spain, With New Insights into the Phylogeny of the Genus and a Revision of its Taxonomy

De Ley et al. (1995) and Abolafia and Peña-Santiago (2017), respectively. Scanning Electron Microscopy (SEM) Specimens preserved in glycerine were selected for observation under SEM according to Abolafia (2015). They were hydrated in distilled water, dehydrated in a graded ethanol-acetone series, critical point dried, coated with gold, and observed with a Zeiss Merlin microscope (5 kV) (Zeiss, Oberkochen, Germany). DNA Extraction, PCR and Sequencing Nematode DNA was extracted from single

Joaquín Abolafia, Reyes Peña-Santiago

journal of nematology , 1–21

Research Article

Description of Aphelenchoides giblindavisi n. sp. (Nematoda: Aphelenchoididae), and Proposal for a New Combination

One new and one known species of the genus Aphelenchoides from Iran are studied. Aphelenchoides giblindavisi n. sp. is mainly characterized by having five lines in the lateral fields at mid-body, and a single mucro with several tiny nodular protuberances, giving a warty appearance to it, as revealed by detailed scanning electron microscopic (SEM) studies. The new species is further characterized by having a body length of 546 to 795 μm in females and 523 to 679 μm in males, rounded lip region

Farzad Aliramaji, Ebrahim Pourjam, Sergio Álvarez-Ortega, Farahnaz Jahanshahi Afshar, Majid Pedram

Journal of Nematology , ISSUE 3, 437–452

Research Article

NTC Thermistors of Y-Al-Mn-Fe-Ni-Cr-O Ceramics for Wide Temperature Range Measurement

NTC thermistors of Y-Al-Mn-Fe-Ni-Cr-O systems were fabricated by using normal ceramic processing for wide temperature range measurement. Pt-Rh alloy as electrodes was inserted into the body during the forming process to increase the reliability of high temperature and to decrease the contact resistance. The properties were analyzed by XRD, SEM and resistance measurement. There are no distinct XRD patterns between Y0.2Al0.1Mn0.27Fe0.16Ni0.27Ox and Y0.2Al0.1Mn0.264Fe0.16 Ni0.264Cr0.012Ox because

Woonyoung Lee, Jinseong Park

International Journal on Smart Sensing and Intelligent Systems , ISSUE 5, 1–4

research-article

Updated description of Paratylenchus lepidus Raski 1975 and P. minor Sharma, Sharma and Khan, 1986 by integrating molecular and ultra-structural observations

et al., 2008, 2009; Van den Berg et al., 2014) have been successfully utilized in pin nematode taxonomy. Recently, several new and known species of nematodes were described based on combined morphological, molecular, and SEM observation (Maria et al., 2018b; Zhuo et al., 2018). Moreover, DNA studies have significant advantages to precisely identify morphologically similar species, such as cryptic species. In an attempt to document the ectoparasitic nematodes from Zhejiang Province, China, two

Munawar Maria, Wentao Miao, Weimin Ye, Jingwu Zheng

journal of nematology , 1–13

Research Article

MICROSTRUCTURING OF SU-8 RESIST FOR MEMS AND BIO-APPLICATIONS

ridge structure. Structural characterization of the fabricated structures were investigated using optical microscope and SEM.

P.K. Dey, B. Pramanick, A. RaviShankar, P. Ganguly, S. Das

International Journal on Smart Sensing and Intelligent Systems , ISSUE 1, 118–129

research-article

Cyberbullying: relationship with developmental variables and cyber victimization

= 0.70). The latter was used to measure repressive emotion in the present study. Analyses The proposed model was analyzed by the structural equation modeling (SEM) in LISREL 8.71. Before the analysis, the data were examined for the assumptions of SEM. The two-stage approach in which the measurement and the structural models are tested separately was preferred in SEM (76). Sample size, missing values, outliers, multicollinearity, linearity and homoscedasticity assumptions were met. Since the data

Gülendam Akgül, Müge Artar

Scandinavian Journal of Child and Adolescent Psychiatry and Psychology , 25–37

Original Research

Description of Pseudacrobeles (Pseudacrobeles) curvatus sp. n. (Cephalobidae: Rhabditida) in South Korea

Jiyeon Kim, Taeho Kim, Joong-Ki Park

Journal of Nematology , ISSUE 2, 162–167

Article

NANOSTRUCTURED Fe2O3 THICK FILM AS AN ETHANOL SENSOR

short response time and large recovery time. Physical and structural properties of the film material were studied by SEM, TEM, XRD and UV spectroscopy.

N. K. Pawar, D. D. Kajale, G. E. Patil, V. G. Wagh, V. B. Gaikwad, M. K. Deore, G. H. Jain

International Journal on Smart Sensing and Intelligent Systems , ISSUE 2, 441–457

Article

EFFECT OF CeO2 DOPING ON THE STRUCTURE, ELECTRICAL CONDUCTIVITY AND ETHANOL GAS SENSING PROPERTIES OF NANOCRYSTALLINE ZnO SENSORS

Nanocrystalline sensors having the general formula ZnO + x wt% CeO2, where x = 0, 2, 4 and 6 were prepared by chemical precipitation method and sintered at 400, 600 and 800 oC for 2h in static air atmosphere. The crystal structure and the morphology of the prepared samples were investigated and characterized by using XRD, IR, SEM and TEM techniques. The investigation revealed that the average crystallites size increases with increasing the sintering temperature. The electrical conductivity is

A. M. El-Sayed, F. M. Ismail, M. H. Khder, M. E. M. Hassouna, S. M. Yakout

International Journal on Smart Sensing and Intelligent Systems , ISSUE 3, 606–623

Article

SYNTHESIS OF NANOSTRUCTURED ZrO2 FOR GAS SENSING APPLICATION

Nanocrystalline ZrO2 (Zirconia) has been synthesized by a conventional precipitation method. The structural, morphological, microstructural, optical and gas-sensing properties of ZrO2 were investigated by using X-ray diffraction analysis (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), UV-vis spectroscopy and static gas sensing unit, respectively. X-ray diffraction pattern and TEM of the synthesized product reveal their nano-crystalline nature with grain size

Pratap G. Patil, D. D. Kajale, V. P. Patil, G. E. Patil, G. H. Jain

International Journal on Smart Sensing and Intelligent Systems , ISSUE 3, 673–684

Original Paper

Simultaneous Biodegradation of Phenol and n-Hexadecane by Cryogel Immobilized Biosurfactant Producing Strain Rhodococcus wratislawiensis BN38

g/l n-hexadecane (40 cycles). The alkanotrophic strain R. wratislawiensis BN38 preferably degraded hexadecane rather than phenol. SEM revealed well preserved cells entrapped in the heterogeneous super-macroporous structure of the cryogel which allowed unhindered mass transfer of xenobiotics. The immobilized strain can be used in real conditions for the treatment of contaminated industrial waste water

Alexander E. Hristov, Nelly E. Christova, Lyudmila V. Kabaivanova, Lilyana V. Nacheva, Ivanka B. Stoineva, Petar D. Petrov

Polish Journal of Microbiology , ISSUE 3, 287–293

research-article

Study on the suitability of ZnO thin film for dynamic pressure sensing application

microstructure, morphology, film thickness and composition using the methods, namely, X-ray diffraction (XRD), scanning electron microscopy (SEM), energy-dispersive spectroscopy (EDS), etc. X-ray diffraction studies (XRD, Bruker D8 Advance Diffractometer, Model No: A18-A100/D76182) with Nickel filtered Cu Kα radiation, λ  =  0.15406 nm, in the 2θ range 20o to 90o were conducted to evaluate the structural properties. Surface morphology and cross-section of the thin films were analyzed using field emission

Suma M. N., Venkateswarlu Gaddam, M. V. N. Prasad, M. M. Nayak, K. Rajanna

International Journal on Smart Sensing and Intelligent Systems , ISSUE 1, 1–9

Research paper

HYDROGEN GAS SENSING PERFORMANCE OF Pt/SnO2 NANOWIRES/SiC MOS DEVICES

M. Shafiei, K. Kalantar-zadeh, W. Wlodarski, E. Comini, M. Ferroni, G. Sberveglieri, S. Kaciulis, L. Pandolfi

International Journal on Smart Sensing and Intelligent Systems , ISSUE 3, 771–783

research-article

The morphological characteristics and phylogenetic analysis of Pratylenchus vulnus Taiwan strawberry isolate

1000X magnification with compound microscope and SEM. Molecular analysis of the ribosomal RNA and mitochondrial gene sequences of the extracted nematodes confirmed their species as P. vulnus (Table 1). The rDNA LSU region (D2A/D3B: ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (Nunn, 1992), rDNA ITS region (TW81/AB28: GTTTCCGTAGGTGAACCTGC/ATATGCTTAAGTTCAGCGGGT) (Amiri et al., 2002; Subbotin et al., 2001), rDNA SSU region (SSU18A/SSU26R: AAAGATTAAGCCATGCATG/CATTCTTGGCAAATGCTTTCG) (Eyualem and

Yu-po Lin, Wan-chun Lee, Pei-che Chung, Jiue-in Yang

Journal of Nematology , 1–5

Article

SYNTHESIS OF ZnO NANORODS BY HYDROTHERMAL METHOD FOR GAS SENSOR APPLICATIONS

ZnO nanorods with different sizes and shapes have been successfully synthesized via a simple hydrothermal route, using zinc acetate and Cetyltriammonium bromide (CTAB) as the reactants. The thick films of as prepared ZnO were prepared by screen-printing technique in desired pattern. The films are characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM) and transmission electron microscopy (TEM). The gas sensing properties of the materials have been investigated for various

Sarika D. Shinde, G. E. Patil, D. D. Kajale, D. V. Ahire, V. B. Gaikwad, G. H. Jain

International Journal on Smart Sensing and Intelligent Systems , ISSUE 1, 57–70

Article

Morphological and Molecular Characteristics of Pratylenchus haiduongensis sp. n., a New Species of Root–Lesion Nematodes Associated with Carrot in Vietnam

THI DUYEN NGUYEN, THI MAI LINH LE, HUU TIEN NGUYEN, THI ANH DUONG NGUYEN, GRACIA LIEBANAS, QUANG PHAP TRINH

Journal of Nematology , ISSUE 3, 276–285

Research Article

Annealing Effect on the Structural and Optical properties of SiOx films deposited by HFCVD

J. A. Luna López, A. Benítez Lara, G. García Salgado, D. Hernández de la Luz, M. Pacio, A. Morales Sanchez, S. A. Perez Garcia

International Journal on Smart Sensing and Intelligent Systems , ISSUE 5, 1–6

Research paper

DEVELOPMENT AND CHARACTERIZATION OF SURFACE MICRO-MACHINED MEMS BASED VARACTOR

Subha Chakraborty, A. Bhattacharya, Ashesh Ray Chaudhuri, T.K. Bhattacharyya

International Journal on Smart Sensing and Intelligent Systems , ISSUE 1, 94–107

research-article

On the identity of Eucephalobus oxyuroides (de Man, 1876) Steiner, 1936 (Rhabditida, Cephalobidae), with an updated taxonomy of the genus and notes about its phylogeny

microscopy (SEM) Specimens preserved in glycerine were selected for observation under SEM according to the methods of Abolafia (2015). They were hydrated in distilled water, dehydrated in a graded ethanol-acetone series, critical point dried, coated with gold, and observed with a Zeiss Merlin microscope (5 kV) (Zeiss, Oberkochen, Germany). Phylogenetic analyses For phylogenetic relationships, analyses were based on 18S and 28S rDNA gene sequences available in GenBank. The sequences were aligned using

Joaquín Abolafia, Reyes Peña-Santiago

Journal of Nematology , 1–20

Article

EFFECT OF ANNEALING ON GAS SENSING PERFORMANCE OF NANOSTRUCTURED ZnO THICK FILM RESISTORS

images show nano-particles as clusters with size in the range of 10-20 nm. Electron diffraction pattern of nano-powders annealed at 900oC temperature shows a well distribution of spherical particles due to the effect of citric acid as surfactant in chemical process. Thick films prepared by screen printing technique from zinc oxide nano-powders annealed at different temperatures (500–900 oC), characterized by SEM analysis and tested for various gases. The film prepared from ZnO powder annealed

Sarika D. Shinde, G. E. Patil, D. D. Kajale, V. G. Wagh, V. B. Gaikwad, G. H. Jain

International Journal on Smart Sensing and Intelligent Systems , ISSUE 1, 277–294

Short Communication

Morphological and Molecular Characterization of Phoma complanata, a New Causal Agent of Archangelica officinalis Hoffm. in Poland

Beata Zimowska, Ewa Dorota Zalewska, Ewa Dorota Król, Agnieszka Furmańczyk

Polish Journal of Microbiology , ISSUE 2, 281–285

original-paper

Structural Changes of Bacillus subtilis Biomass on Biosorption of Iron (II) from Aqueous Solutions: Isotherm and Kinetic Studies

/qt, respectively. Scanning Electron Microscopy (SEM) and Energy Dispersive X-ray spectrometry (EDX) analysis. Morphology and elemental composition of biosorbent before and after biosorption with Fe(II) ions were examined by the Field Emission Scanning Electron Microscope (FE-SEM) (CARL ZEISS SUPRA 55 GEMIN-German Technology Jena, Germany). Biomass samples were glutaraldehyde fixed, attached to 10 mm alumina-based mounts and sputtered with gold particles by using sputter coater (SC7620 ‘Mini

SRI LAKSHMI RAMYA KRISHNA KANAMARLAPUDI, SUDHAMANI MUDDADA

Polish Journal of Microbiology , ISSUE 4, 549–558

research-article

Cephalenchus driekieae n. sp. (Nematoda: Tylenchidae) from South Africa, a new member of the genus with a long pharyngeal overlap

as template to redraw in CorelDRAW® software version 2018. Scanning electron microscopy (SEM) For SEM, the nematodes mounted on permanent slides were cleaned and hydrated in distilled water, dehydrated in a graded ethanol-acetone series, critical point dried, coated with gold, and observed with a Zeiss Merlin microscope (5 kV) (Zeiss, Oberkochen, Germany) (Abolafia, 2015). DNA extraction, PCR reaction, and gel electrophoresis DNA extraction and PCR conditions followed Rashidifard et al. (2019

Milad Rashidifard, Gerhard Du Preez, Joaquín Abolafia, Majid Pedram

Journal of Nematology , 1–10

Article

PREPARATION AND CHARACTERIZATION OF ZIRCONIA BASED THICK FILM RESISTOR AS A AMMONIA GAS SENSOR

Thick film technique is popular because of low cost, simple for construction and better sensing surface area, hence for resistive gas sensor thick films of pure ZrO2 powder were prepared by Standard screen printing technique. The material was characterized by X-Ray diffraction pattern, surface morphology was observed by SEM, elemental composition were observed by EDAX and optical properties were studied with UV spectroscopy Techniques, electrical properties were studying with different applied

S. B. Deshmukh, R. H. Bari, G. E. Patil, D. D. Kajale, G. H. Jain, L. A. Patil

International Journal on Smart Sensing and Intelligent Systems , ISSUE 3, 540–558

Research Article

Pure and Cupricated BaSnO3 thick film resistor: Synthesis, Characterization and studies on its gas sensing performance

for gas concentration of 50 ppm with film dipped for 10 min. time interval. The characterization of the films was done by XRD, SEM and TG-DTA. Crystallite size, texture coefficient, specific surface area, electric properties and gas sensitivity of the films were measured and presented.

N.U. PATIL, V.B. GAIKWAD, P.D. HIRE, R.M. CHAUDHARI, M. K. DEORE, G. H. JAIN

International Journal on Smart Sensing and Intelligent Systems , ISSUE 1, 433–447

research-article

THE INTERACTIONS BETWEEN ANTI-FOAMING AND SUPERPLASTICIZING ADMIXTURES AND THEIR CONSEQUENCE FOR PROPERTIES OF SELF-COMPACTING MORTAR AND CONCRETE

procedure [26], density test – in accordance with EN 12350-6:2000 [27], air content – the pressure method according to EN 12350-7:2001 [28]. The compressive strength of concrete was investigated according to EN 12390-3 [30]. The microstructure and porosity of hardened concrete P1, P2, P1A6b, after 28 days curing in water, were investigated using the following methods: porosity structure parameters are investi-gated according to PN-EN 480-11 [29], the microstructure of concrete according to SEM (Scanning

Beata ŁAŹNIEWSKA-PIEKARCZYK

Architecture, Civil Engineering, Environment , ISSUE 4, 61–71

research-article

New data on known species of Hirschmanniella and Pratylenchus (Rhabditida, Pratylenchidae) from Iran and South Africa

. Scanning electron microscopy (SEM) Specimens preserved in glycerine were selected for observation under SEM according to Abolafia (2015). The nematodes were hydrated in distilled water, dehydrated in a graded ethanol-acetone series, critical point dried, coated with gold, and observed with a Zeiss Merlin microscope (5 kV) (Zeiss, Oberkochen, Germany). Statistical analysis Principal component analysis and the correlation of morphometric data using the Pearson method was done by XLSTAT (Addinsoft, 2007

Ebrahim Shokoohi, Joaquín Abolafia, Phatu William Mashela, Nafiseh Divsalar

Journal of Nematology , 1–26

Research Article

As-growth and Annealing Porous Silicon Mirrors for Optical Applications in the UV

this case for multilayer as-growth, and subsequently a dry oxidation was performed to observe the change in refractive index and reflectance. A model that contains the refractive index of silicon, air and silicon oxide is used for predicting the behavior of the reflectance spectra. With this model is possible to control the width of the reflectance spectrum of the band pass or also called Distributed Bragg Reflector (DBR), DBR were characterized and measured by SEM and UV-VIS spectroscopy

F. Morales Morales, G. García Salgado, J. A. Luna López, T. Díaz, E. Rosendo, H. Juárez, K. Monfil Leyva, D. Hernández de la Luz

International Journal on Smart Sensing and Intelligent Systems , ISSUE 5, 1–6

Article

Coronostoma claireae n. sp. (Nematoda: Rhabditida: Oxyuridomorpha: Coronostomatidae) from the Indigenous Milliped Narceus gordanus (Chamberlain, 1943) (Diplopoda: Spirobolida) in Ocala National Forest, Florida

GARY PHILLIPS, ERNEST C. BERNARD, ROBERT J. PIVAR, JOHN K. MOULTON, ROWLAND M. SHELLEY

Journal of Nematology , ISSUE 3, 159–169

research-article

Description of Geocenamus vietnamensis sp. n. (Nematoda: Merliniidae) from Vietnam

using the ZEN lite software on ZEISS Axiocam ERc5s digital camera. Raw photographs were edited with Adobe Illustrator CS 3. Scanning electron microscopy (SEM) After examination and identification, good specimens were selected for SEM imaging, following the protocol of Abolafia (2015). The nematodes were hydrated in distilled water, dehydrated in a graded ethanol and acetone series, critical point dried, coated with gold, and observed with a Zeiss Merlin Scanning Electron Microscope. Molecular

Huu Tien Nguyen, Thi Mai Linh Le, Thi Duyen Nguyen, Gracia Liebanas, Thi Anh Duong Nguyen, Quang Phap Trinh

Journal of Nematology , 1–12

Research Article

Incidence of Oscheius onirici (Nematoda: Rhabditidae), a potentially entomopathogenic nematode from the marshlands of Wisconsin, USA

mitochondrial cytochrome oxidase subunit 1 (CoxI) genes revealed this as Oscheius onirici, a species recently described from a karst cave soil of central Italy. The species belongs to the dolichura-group and is characterized by its DNA sequences; hermaphroditic reproduction; and males not found. A Bacillus-like bacterium appears to be associated with this nematode based on our microscopic and SEM observations; however its identity and persistent association with the nematode has not been confirmed

Weimin Ye, Shane Foye, Ann E. MacGuidwin, Shawn Steffan

Journal of Nematology , ISSUE 1, 9–26

research-article

A new stunt nematode, Geocenamus chengi n. sp. (Nematoda: Merliniinae) in the rhizosphere of tea (Camellia sinensis) from Zhejiang Province, China

possesses unique characters and needs to be considered as a new member of the genus. Therefore, this study describes a new Geocenamus species with the following objectives: to provide an integrative morphological and molecular characterization of the new species; to elucidate important morphological details through SEM observations; and to study the phylogenetic relationships of these species with other merlinid and related nematodes. Materials and methods Nematode extraction and morphological study

Munawar Maria, Wentao Miao, Pablo Castillo, Jingwu Zheng

Journal of Nematology , 1–13

research-article

Serendipitous identification of Pratylenchus curvicauda from the grainbelt of Western Australia

Pingelly with typical P. curvicauda features were fixed in 4% formaldehyde solution and sent to an expert taxonomist in the UK for further characterization. The detailed morphometric measurements obtained were compared with those taken in Australia. Preparation of nematode samples for scanning electron microscopy Scanning electron microscopy (SEM) was used to further characterize P. curvicauda. To do this, single nematodes were fixed in 3% glutaraldehyde in 0.025 M phosphate buffer (pH 7.0) overnight

Farhana Begum, John Fosu-Nyarko, Shashi Sharma, Bill Macleod, Sarah Collins, Michael G. K. Jones

Journal of Nematology , 1–15

No Record Found..
Page Actions