Search

  • Select Article Type
  • Abstract Supplements
  • Blood Group Review
  • Call to Arms
  • Hypothesis
  • In Memoriam
  • Interview
  • Introduction
  • Short Report
  • abstract
  • Abstracts
  • Article
  • book-review
  • case-report
  • case-study
  • Clinical Practice
  • Commentary
  • Conference Presentation
  • conference-report
  • congress-report
  • Correction
  • Editorial
  • Editorial Comment
  • Erratum
  • Events
  • Letter
  • Letter to Editor
  • mini-review
  • minireview
  • News
  • non-scientific
  • Obituary
  • original-paper
  • Original Research
  • Pictorial Review
  • Position Paper
  • Practice Report
  • Preface
  • Preliminary report
  • Product Review
  • rapid-communication
  • Report
  • research-article
  • Research Communicate
  • research-paper
  • Research Report
  • Review
  • review -article
  • review-article
  • Review Paper
  • Sampling Methods
  • Scientific Commentary
  • short-communication
  • short-report
  • Student Essay
  • Varia
  • Welome
  • Select Journal
  • Polish Journal Of Microbiology
  • Journal Of Nematology
  • Immunohematology

 

Case report | 01-December-2019

Molecular analysis of patients with weak D and serologic analysis of those with anti-D (excluding type 1 and type 2)

type 4.2.2, in 1 of 18 with weak D type 11, in 1 of 17 with weak D type 15, and in 1 weak D type 33 individual. Anti-D was demonstrated to be an alloantibody in weak D type 4.0, type 4.2.2, and type 15 individuals, but an autoantibody in weak D type 11 and type 33 individuals. In conclusion, only a complete serologic investigation of individuals with a given weak D type identified by molecular analysis allows concluding on the nature of the antibody. Transfusing weak D type 4.2.2 and type 15

Bach-Nga Pham, Michèle Roussel, Dominique Gien, Maryline Ripaux, Carine Auxerre, Pierre-Yves Le Pennec, Christine Andre-Botte

Immunohematology, Volume 29 , ISSUE 2, 55–62

research-article | 28-April-2020

Morphological and molecular characterization of Pungentus sufiyanensis n. sp. and additional data on P. engadinensis (Altherr, 1950) Altherr, 1952 (Dorylaimida: Nordiidae) from northwest of Iran

Nasir Vazifeh, Gholamreza Niknam, Habibeh Jabbari, Reyes Peña-Santiago

Journal of Nematology, Volume 52 , 1–12

Report | 25-March-2020

Principles of PCR-based assays

Kim Hue-Roye, Sunitha Vege

Immunohematology, Volume 24 , ISSUE 4, 170–175

research-article | 30-November-2019

On the identity of Eucephalobus oxyuroides (de Man, 1876) Steiner, 1936 (Rhabditida, Cephalobidae), with an updated taxonomy of the genus and notes about its phylogeny

Joaquín Abolafia, Reyes Peña-Santiago

Journal of Nematology, Volume 52 , 1–20

Article | 03-December-2017

Taxonomy and Systematics of the Genus Makatinus Heyns, 1965 (Nematoda: Dorylaimida: Aporcelaimidae)

REYES PENA-SANTIAGO, INGRID VARELA

Journal of Nematology, Volume 49 , ISSUE 3, 245–253

Research Article | 26-September-2018

Occurrence of Sheraphelenchus sucus (Nematoda: Aphelenchoidinae) and Panagrellus sp. (Rhabditida: Panagrolaimidae) Associated with Decaying Pomegranate Fruit in Italy

ELENA FANELLI, ALBERTO TROCCOLI, NICOLA VOVLAS, GIANLUCA SCARCIA, ANNAMARIA MINCUZZI, SIMONA M. SANZANI, ANTONIO IPPOLITO, FRANCESCA DE LUCA

Journal of Nematology, Volume 49 , ISSUE 4, 418–426

research-article | 19-February-2021

First morphological and molecular identification of third-stage larvae of Anisakis typica (Nematoda: Anisakidae) from marine fishes in Vietnamese water

on morphological characteristics and molecular analysis, from eight marine fish species in the South of Vietnamese water and recorded seven fish species as new intermediate hosts of this Anisakis nematode. Genetically, the ITS1-5.8S-ITS2 sequences of Vietnamese A. typica were close to those from Asian countries and Australia, to make a common group separated from another group from America and Europe.

Hoang Van Hien, Bui Thi Dung, Ha Duy Ngo, Pham Ngoc Doanh

Journal of Nematology, Volume 53 , 1–9

research-article | 30-November-2019

First report of Meloidogyne javanica infecting Zinnia elegans in Ceará State, Brazil

Francisco Jorge Carlos Souza Junior, Mayara Castro Assunção

Journal of Nematology, Volume 52 , 1–4

research-article | 30-November-2018

Morphological and Molecular Characterization of Oscheius saproxylicus sp. n. (Rhabditida, Rhabditidae) From Decaying Wood in Spain, With New Insights into the Phylogeny of the Genus and a Revision of its Taxonomy

., 2017) have repeatedly confirmed the monophyly of both Insectivorus- and Dolichura-groups, and most of them agree that these groups are sister groups. Nevertheless, two contributions (Darsouei et al., 2014; Zhou et al., 2017) do not support this idea. The molecular analysis of 18S and 28S rDNA sequences of the new species herein described, whose results are presented in the trees of Figures 4 and 5, respectively, confirm the monophyly of both species groups as well as that they are sister groups

Joaquín Abolafia, Reyes Peña-Santiago

journal of nematology, Volume 51 , 1–21

Report | 25-March-2020

DNA-based assays for patient testing: their application, interpretation, and correlation of results

Christine Lomas-Francis, Helene DePalma

Immunohematology, Volume 24 , ISSUE 4, 180–190

Short Communication | 28-June-2017

Morphological and Molecular Characterization of Phoma complanata, a New Causal Agent of Archangelica officinalis Hoffm. in Poland

The paper concerns the fungus Phoma complanata, isolated for the first time in Poland, from the roots and umbels of angelica (Archangelica officinalis) in 2009. The morphology of fungal isolates was tested on standard culture media. Moreover, the sequence analysis of ITS regions was conducted. Morphological similarity of P. complanata Polish isolates to the reference isolate obtained from CBS culture collection was determined and together with the molecular analysis confirmed the affiliation of

Beata Zimowska, Ewa Dorota Zalewska, Ewa Dorota Król, Agnieszka Furmańczyk

Polish Journal of Microbiology, Volume 66 , ISSUE 2, 281–285

research-article | 30-November-2020

Detection of Pratylenchus zeae and P. brachyurus parasitizing plants from the caatinga biome, Ceará, Brazil

) μm and c′ = 2.10 ± 0.33 (1.84-2.52) μm. Total body length was 535.33 ± 21.58 (508.63-562.70) μm, with a = 24.47 ±1.37 (23.36-27.91) μm, b = 7.73 ± 1.01 (6.14-9.50) μm, and b′ = 4.22 ± 0.53 (3.67-5.15) μm. The sequences of the studied rDNA regions were submitted to GenBank (ITS: MT994745, MW350685-MW350688 and D2-D3 28S: MT994748, MW349659-MW349662). The populations CFN001, CFN003, CFN004, and CFN005 used for molecular analysis showed a high degree of sequence identity (99%) with P. zeae from

Francisco Jorge Carlos Souza Junior, Mayara Castro Assunção

Journal of Nematology, Volume 53 , 1–5

research-article | 30-November-2019

First report of root-knot nematodes (Meloidogyne species) infecting Chinese Elm (Ulmus parvifolia) in Florida, USA

M. R. Moore, J. A. Brito, S. Qiu, C. G. Roberts, L. A. Combee

Journal of Nematology, Volume 52 , 1–4

research-article | 30-November-2020

First report of root-knot nematode, Meloidogyne incognita, infecting hops, Humulus lupulus, in São Paulo, Brazil

. The identification of the nematode characterized as Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949, was based on morphological characters of adults, esterase phenotypes (n = 16), and molecular analysis. Morphological identification was performed by analyzing the male labial region, and presented a trapezoidal shape and prominent concave labial disk compared to the submedian lips and transverse striations on the head annule; the stylet basal knobs were higher than wide (n  = 12; Fig

R. F. Gonsaga, A. Souza Pollo, D. D. Nascimento, R. J. Ferreira, L. T. Braz, P. L. M. Soares

Journal of Nematology, Volume 53 , 1–4

research-article | 30-November-2018

The morphological characteristics and phylogenetic analysis of Pratylenchus vulnus Taiwan strawberry isolate

1000X magnification with compound microscope and SEM. Molecular analysis of the ribosomal RNA and mitochondrial gene sequences of the extracted nematodes confirmed their species as P. vulnus (Table 1). The rDNA LSU region (D2A/D3B: ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (Nunn, 1992), rDNA ITS region (TW81/AB28: GTTTCCGTAGGTGAACCTGC/ATATGCTTAAGTTCAGCGGGT) (Amiri et al., 2002; Subbotin et al., 2001), rDNA SSU region (SSU18A/SSU26R: AAAGATTAAGCCATGCATG/CATTCTTGGCAAATGCTTTCG) (Eyualem and

Yu-po Lin, Wan-chun Lee, Pei-che Chung, Jiue-in Yang

Journal of Nematology, Volume 51 , 1–5

Case report | 12-March-2020

Alloimmunization to the D antigen by a patient with weak D type 21

Antibodies of apparent D specificity may be found in D+ patients. We report a D+, multi-transfused Caucasian woman with myelodysplasia who exhibited several alloantibodies. One antibody was a moderately strong (2+) anti-D that persisted for 9 months, until the woman died. Molecular analysis of the patient’s RHD gene identified the rare weak D type 21 (938C>T) allele. D alloantibodies do not occur in patients with most weak D types, but some patients with a weak D phenotype, including

Heather McGann, Robert E. Wenk

Immunohematology, Volume 26 , ISSUE 1, 27–29

research-article | 14-December-2020

Morphological, morphometrical, and molecular characterization of Metarhabditis amsactae (Ali, Pervez, Andrabi, Sharma and Verma, 2011) Sudhaus, 2011 (Rhabditida, Rhabditidae) from India and proposal of Metarhabditis longicaudata as a junior synonym of M. amsactae

Jacob, 2012, and Oscheius amsactae Ali, Pervez, Andrabi, Sharma and Verma, 2011 and Metarhabditis longicaudata Tabassum, Salma and Nasir, 2019. Most of these studies, however, have characterized the species morphologically and morphometrically. Regarding molecular analysis, several Internal Transcribed Spacer (ITS) rDNA sequences, obtained from M. amsactae isolated in India, Philippines, and Pakistan have been deposited in the GenBank, but none of the nematode specimens used to obtain the sequences

Aashaq Hussain Bhat, Shreyansh Srivastava, Aasha Rana, Ashok Kumar Chaubey, Ricardo A. R. Machado, Joaquín Abolafia

Journal of Nematology, Volume 52 , 1–23

research-article | 30-November-2018

First record of Aphelenchoides stammeri (Nematoda: Aphelenchoididae) from Turkey

Mehmet Dayi, Ece B. Kasapoğlu Uludamar, Süleyman Akbulut, İ. Halil Elekcioğlu

journal of nematology, Volume 51 , 1–6

research-article | 30-November-2019

First report of Meloidogyne naasi parasitizing turfgrass in Portugal

M. Clara Vieira dos Santos, M. Teresa M. Almeida, Sofia R. Costa

Journal of Nematology, Volume 52 , 1–4

research-article | 06-November-2020

Morphological and molecular characterization of Epidorylaimus procerus sp. n. (Dorylaimida: Qudsianematidae) from Vietnam

Thi Anh Duong Nguyen, Reyes Peña-Santiago

Journal of Nematology, Volume 52 , 1–8

research-article | 26-March-2021

First report of Bitylenchus ventrosignatus (Tobar Jiménez, 1969) Siddiqi, 1986 associated with wild grass in Botswana

The genus Bitylenchus belongs to the family Dolichodoridae Chitwood in Chitwood, 1950. This genus has been synonymized with Tylenchorhynchus (Geraert, 2011). However, Handoo et al. (2014) and Hosseinvand et al. (2020) considered it as a valid taxon using molecular analysis. Siddiqi (2000) considered 29 valid species under the genus Bitylenchus. Members of Bitylenchus and Tylenchorhynchus differ in areolated outer bands of lateral fields, a large postanal intestinal sac containing intestinal

Ebrahim Shokoohi

Journal of Nematology, Volume 53 , 1–9

research-article | 16-April-2019

Description of a new dagger nematode, Xiphinema barooghii n. sp. (Nematoda: Longidoridae) and additional data on the three known species of the genus from northwest of Iran

were deposited at Nematology Collection of the Department of Plant Protection, Faculty of Agriculture, University of Tabriz, Tabriz, Iran. Two paratype females were also deposited at Nematode Collection of the University of Jaen, Spain. Etymology The new species is named in honor of Dr. Hassan Barooghi, the late Entomologist and Associate Professor in Department of Plant Protection, University of Tabriz, Tabriz, Iran. Molecular characterization and phylogeny For molecular analysis, one D2–D3

Nasir Vazifeh, Gholamreza Niknam, Habibeh Jabbari, Arezoo Naghavi

Journal of Nematology, Volume 51 , 1–17

Original Paper | 10-December-2018

Aspergillus penicillioides Speg. Implicated in Keratomycosis

Abstract The aim of the study was mycological examination of ulcerated corneal tissues from an ophthalmic patient. Tissue fragments were analyzed on potato-glucose agar (PDA) and maltose (MA) (Difco) media using standard laboratory techniques. Cultures were identified using classical and molecular methods. Macro- and microscopic colony morphology was characteristic of fungi from the genus Aspergillus (restricted growth series), most probably Aspergillus penicillioides Speg. Molecular analysis

EULALIA MACHOWICZ-MATEJKO, AGNIESZKA FURMAŃCZYK, EWA DOROTA ZALEWSKA

Polish Journal of Microbiology, Volume 67 , ISSUE 4, 407–416

Research Article | 03-September-2018

Nothotylenchus andrassy n. sp. (Nematoda: Anguinidae) from Northern Iran

anus distance); and elongate, conical tail with pointed tip. Nothotylenchus andrassy n. sp. is morphologically similar to five known species of the genus, namely Nothotylenchus geraerti, Nothotylenchus medians, Nothotylenchus affinis, Nothotylenchus buckleyi, and Nothotylenchus persicus. The results of molecular analysis of rRNA gene sequences, including the D2–D3 expansion region of 28S rRNA, internal transcribed spacer (ITS) rRNA and partial 18S rRNA gene are provide for the new species.

Parisa Jalalinasab, Mohsen Nassaj Hosseini, Ramin Heydari

Journal of Nematology, Volume 50 , ISSUE 2, 219–228

Article | 21-July-2017

Occurrence of Panagrellus (Rhabditida: Panagrolaimidae) Nematodes in a Morphologically Aberrant Adult Specimen of Rhynchophorus ferrugineus (Coleoptera: Dryophthoridae)

An aberrant specimen of Rhynchophorus ferrugineus (Coleoptera: Dryophthoridae) also known as red palm weevil (RPW), the most economically important insect pest of palms in the world, was found among a batch of conspecifics reared for research purposes. A morphological analysis of this weevil revealed the presence of nematodes associated with a structured cuticle defect of the thorax. These nematodes were not able to be cultured, but were characterized by molecular analysis using 28S

MANUELA CAMEROTA, GIUSEPPE MAZZA, LYNN K. CARTA, FRANCESCO PAOLI, GIULIA TORRINI, CLAUDIA BENVENUTI, BEATRICE CARLETTI, VALERIA FRANCARDI, PIO FEDERICO ROVERSI

Journal of Nematology, Volume 48 , ISSUE 1, 1–6

Original Paper | 30-June-2018

Screening and Identification of Trichoderma Strains Isolated from Natural Habitats with Potential to Cellulose and Xylan Degrading Enzymes Production

morphological and molecular analysis, the isolates were identified as Trichoderma. The most frequently identified strains belonged to Trichoderma harzianum species. Among all strains, the most effective in degradation of cellulose and xylose was T. harzianum and T. virens, especially those isolated from forest wood, forest soil or garden and mushroom compost. The results of this work confirmed that numerous strains from the Trichoderma species have high cellulose and xylan degradation potential and could be

ROMAN MARECIK, LIDIA BŁASZCZYK, RÓŻA BIEGAŃSKA-MARECIK, AGNIESZKA PIOTROWSKA-CYPLIK

Polish Journal of Microbiology, Volume 67 , ISSUE 2, –

research-article | 30-November-2019

First record of native entomopathogenic nematodes from Montana agroecosystems

Ramandeep K. Sandhi, Ratnasri Pothula, Satyendra K. Pothula, Byron J. Adams, Gadi V.P. Reddy

Journal of Nematology, Volume 52 , 1–11

research-article | 30-November-2019

First report of the stubby-root nematode Nanidorus minor infecting Paspalum vaginatum, seashore paspalum grass in Georgia, USA

-27.3) μm; b 5.0 (4.6-6.0) μm; and V 51.4% (47.5-54.1%) μm. Measurements of morphological characters of adult females were similar to N. minor (Colbran) Siddiqi (Decraemer, 1995; Hajihassani et al., 2018a). Due to similar morphometrics of N. minor and closely related species of Nanidorus, a molecular analysis was first performed to confirm the morphological identification by targeting three different regions of the genomic DNA. Briefly, DNA samples were extracted from single stubby-root nematodes (n

Ganpati B. Jagdale, Fereidoun Forghani, Katherine Martin, Abolfazl Hajihassani, Alfredo Dick Martinez-Espinoza

Journal of Nematology, Volume 52 , 1–3

Article | 16-February-2021

An update on the Cartwright (Yt) blood group system

M.R. George

Immunohematology, Volume 35 , ISSUE 4, 154–155

Article | 21-July-2017

New Cyst Nematode, Heterodera sojae n. sp. (Nematoda: Heteroderidae) from Soybean in Korea

–30 mm). It is distinguished from H. elachista by larger cyst (513.4–778.3 mm3 343.4–567.1 mm vs. 350–560 mm 3 250–450 mm) and longer stylet length of J2 (23.8–25.3 mm vs. 17–19 mm). Molecular analysis of rRNA large subunit (LSU) D2–D3 segments and ITS gene sequence shows that H. sojae n. sp. is more close to rice cyst nematode H. elachista than H. glycines. Heterodera sojae n. sp. was widely distributed in Korea. It was found from soybean

HEONIL KANG, GEUN EUN, JIHYE HA, YONGCHUL KIM, NAMSOOK PARK, DONGGEUN KIM, INSOO CHOI

Journal of Nematology, Volume 48 , ISSUE 4, 280–289

research-article | 30-November-2020

New insights into the identity of Discolaimium dubium Das, Khan and Loof, 1969 (Dorylaimida) as derived from its morphological and molecular characterization, with the proposal of its transference to Aporcella Andrássy, 2002

Nasir Vazifeh, Gholamreza Niknam, Habibeh Jabbari, Arezoo Naghavi, Reyes Peña-Santiago

Journal of Nematology, Volume 53 , 1–12

research-article | 30-March-2020

Characterization of Vittatidera zeaphila (Nematoda: Heteroderidae) from Indiana with molecular phylogenetic analysis of the genus

Andrea M. Skantar, Zafar A. Handoo, Mihail R. Kantor, Lynn K. Carta, Jamal Faghihi, Virginia Ferris

Journal of Nematology, Volume 52 , 1–8

research-article | 30-November-2019

Molecular and morphological characterization of the amaryllis lesion nematode, Pratylenchus hippeastri (Inserra et al., 2007), from California

), body width (20.0, 15.0-28.5), head end to posterior end of esophageal glands (104.0, 98.0-111.0), anal body width (12.0, 10.5-13.0), tail length (26.0, 21.0-29.0), a (25.0, 20.0-32.0), b (4.2, 3.6-4.7), c (17.0, 15.0-21.0), c’ (2.1, 1.6-2.5) and V (77.0%, 74.0-79.0%). Four lines are present in the lateral field. The morphometric details of females were recorded and compared to closely related species which were consistent with Pratylenchus hippeastri (Inserra et al., 2007). Molecular analysis

Zafar A. Handoo, Andrea M. Skantar, Mihail R. Kantor, Saad L. Hafez, Maria N. Hult

Journal of Nematology, Volume 52 , 1–5

research-article | 30-November-2018

Integrative taxonomy of Xiphinema histriae and Xiphinema lapidosum from Spain

Ruihang Cai, Antonio Archidona-Yuste, Carolina Cantalapiedra-Navarrete, Juan E. Palomares-Rius, Jingwu Zheng, Pablo Castillo

Journal of Nematology, Volume 51 , 1–21

Article | 10-April-2021

Transfusion support during childbirth for a woman with anti-U and the RHD*weak D type 4.0 allele

recommended in 20152 to phase-in RHD genotyping for patients with a serologic weak D phenotype. The same authors3 specified their recommendation in 2020 to phase-out the reporting of a “serologic weak D phenotype” and resolve all weak D types with RHD genotyping. We report a pregnant woman with anti-U and a serologic weak D phenotype. The clinical workup in this case illustrated the importance of molecular analysis of serologic weak D phenotypes early in the pregnancy to preserve rare D– RBC units and to

Q. Yin, K. Srivastava, D.G. Brust, W.A. Flegel

Immunohematology, Volume 37 , ISSUE 1, 1–4

Original Paper | 30-June-2018

Distribution of Cell Envelope Proteinases Genes among Polish Strains of Lactobacillus helveticus

production, bacterial growth rate in milk as well as liberation of biologically active peptides. The study reveals significant differences in the presence of various variants of CEPs encoding genes among ten novel Polish strains and indicates the intraspecific diversity exhibited by L. helveticus. In terms of distribution of CEPs genes, four different genetic profiles were found among the microorganisms analyzed. Furthermore, the strains exhibited also various levels of proteolytic activity. Molecular

KATARZYNA W. SKRZYPCZAK, WALDEMAR Z. GUSTAW, ADAM D. WAŚKO

Polish Journal of Microbiology, Volume 67 , ISSUE 2, 203–211

original-paper | 05-August-2020

Molecular Identification and Prevalence of Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii in Erbil City, Northern Iraq

personal status, residency, and source of water supply. The collected fresh stool samples were microscopically examined using the iodine and saline wet mount microscopy to detect Entamoeba trophozoites and/or cysts. About 0.2 g of each specimen was preserved at –80°C for molecular analysis. DNA was extracted from specimens using the QiaAmp Fast DNA Stool Mini Kit (Qiagen, Hilden, Germany) following the manufacturer protocol. Finally, the purified DNA concentrate was eluted from the silica membrane spin

SHLER AKRAM FAQE MAHMOOD, HAWRI MUSTAFA BAKR

Polish Journal of Microbiology, Volume 69 , ISSUE 3, 263–272

Research Article | 03-September-2018

Molecular Characterization and Phylogeny of Ditylenchus weischeri from Cirsium arvense in the Prairie Provinces of Canada

molecular analysis of many D. weischeri specimens from Canada is presented. Individuals from 41C. arvense or yellow pea grain samples with seeds of C. arvense from the Prairie Provinces were sequenced for the internal transcribed spacer (ITS rDNA), large subunit (LSU) D2D3 28S rDNA, partial segment of small subunit (SSU) 18S rDNA, and the heat shock protein Hsp90 gene. The analysis also included D. weischeri individuals from C. arvense from Russia and garlic with D. dipsaci from the Provinces of Ontario

Mehrdad Madani, Mario Tenuta

Journal of Nematology, Volume 50 , ISSUE 2, 163–182

research-article | 30-November-2018

Cryphodera gayae n. sp. (Nematoda: Heteroderidae), from root of Lagerstroemia indica in Korea

) and observed under a scanning electron microscope (Jeol JSM-6390) at 10 kV. Molecular study For molecular analysis, DNA was extracted with DNeasy Blood and Tissue Kit (Qiagen Inc., Valencia, CA). Two rRNA fragments, i.e. the LSU D2–D3 and ITS regions, were amplified. Primers for D2–D3 segments amplification were D2A (5′-ACAAGTACCGTGAGGGAAAGTTG-3′) and D3B (5′-TCGGAAGGAACCAGCTACTA-3′). Primers for ITS amplification were TW81 (5′-GTTTCCGTAGGTGAACCTGC-3′) and AB28 (5′-ATATGCTTAAGTTCAGCGGGT-3

Heonil Kang, Jongmin Seo, Garam Han, Donggeun Kim, Insoo Choi

Journal of Nematology, Volume 51 , 1–12

Article | 24-July-2017

First Report of the Fig Cyst Nematode, Heterodera fici Kirjanova, on Fig Tree, Ficus carica, in Ontario, Canada

National collection of Insects, Arachnids, and Nematodes (Accession no. 14851 to 14853 for the second stage juveniles and 14854–14855 for the cyst cones). For molecular analysis,DNA was extracted from individual juvenile (n = 4) from different cysts. A 1,151-bp fragment of ribosomal DNA containing ITS1-5.8SITS2 region was amplified and sequenced using primers 18S (5'-TTGATTACGTCCCTGCCCTTT-3') and 26S (5'- TTTCACTCGCCGTTACTAAGG-3') (Vrain et al., 1992). The sequence was

FENGCHENG SUN, NEIL HENRY, QING YU

Journal of Nematology, Volume 49 , ISSUE 2, 131–132

No Record Found..
Page Actions