Search

  • Select Article Type
  • Abstract Supplements
  • Blood Group Review
  • Call to Arms
  • Communications
  • Hypothesis
  • In Memoriam
  • Interview
  • Introduction
  • Letter to the Editor
  • Short Report
  • abstract
  • Abstracts
  • Article
  • book-review
  • case-report
  • case-study
  • Clinical Practice
  • Commentary
  • Conference Presentation
  • conference-report
  • congress-report
  • Correction
  • critical-appraisal
  • Editorial
  • Editorial Comment
  • Erratum
  • Events
  • in-memomoriam
  • Letter
  • Letter to Editor
  • mini-review
  • minireview
  • News
  • non-scientific
  • Obituary
  • original-paper
  • original-report
  • Original Research
  • Pictorial Review
  • Position Paper
  • Practice Report
  • Preface
  • Preliminary report
  • Product Review
  • rapid-communication
  • Report
  • research-article
  • Research Communicate
  • research-paper
  • Research Report
  • Review
  • review -article
  • review-article
  • review-paper
  • Review Paper
  • Sampling Methods
  • Scientific Commentary
  • serologic-method-review
  • short-communication
  • short-report
  • Student Essay
  • Varia
  • Welome
  • Select Journal
  • Polish Journal Of Microbiology
  • Journal Of Nematology

 

research-article | 03-June-2019

PCR amplification of a long rDNA segment with one primer pair in agriculturally important nematodes

Eukaryotic nuclear ribosomal DNA (rDNA) is arranged in tandem repeat arrays in the genome. Each repeat unit consists of one copy of small subunit (SSU) 18S, internal transcribed spacers (ITS1 and ITS2), 5.8S, and large subunit (LSU) 28S rDNA, and is separated by an external transcribed spacer (EST) and an intergenic spacer (IGS) (Hillis and Dixon, 1991). The copy number of the repeats within most eukaryotic genomes is high, which provide large quantities of template DNA for PCR. In

L. K. Carta, S. Li

Journal of Nematology, Volume 51 , 1–8

research-article | 24-April-2020

Cephalenchus driekieae n. sp. (Nematoda: Tylenchidae) from South Africa, a new member of the genus with a long pharyngeal overlap

Milad Rashidifard, Gerhard Du Preez, Joaquín Abolafia, Majid Pedram

Journal of Nematology, Volume 52 , 1–10

research-article | 17-March-2020

Improvement of long segment ribosomal PCR amplification for molecular identification of Litylenchus crenatae mccannii associated with beech leaf disease

USA where related species may exist. Molecular and morphological taxonomic identifications were conducted in our lab with the nematodes isolated from the lesions of the BLD leaves collected in Fall, 2017 from Perry, Lake County, Ohio, USA by an Ohio Department of Agriculture nursery inspector from ailing American beech trees Fagus grandifolia (Fall specimens). Their ribosomal DNA (rDNA) loci were amplified by PCR with the one primer set and an enhanced DNA polymerase system, and the resulting 3.5

L.K. Carta, S. Li

Journal of Nematology, Volume 52 , 1–15

Research Article | 03-September-2018

Molecular Identification of Entomopathogenic Nematode Isolates from the Philippines and their Biological Control Potential Against Lepidopteran Pests of Corn

In search for local entomopathogenic nematode (EPN) species as a biological control agent of lepidopterous insect pests of corn, a survey for EPN in the major islands in the Philippines was conducted. Seven EPN populations from 279 soil samples were isolated using Ostrinia furnacalis, the key target insect pest of corn in the country, as bait. Analysis of the ITS1-5.8S-ITS2 ribosomal DNA sequence revealed the presence of Steinernema abbasi, Steinernema minutum, Steinernema tami, and

Barbara L. Caoili, Romnick A. Latina, Regina Faye C. Sandoval, Joey I. Orajay

Journal of Nematology, Volume 50 , ISSUE 2, 99–110

research-article | 30-November-2020

Morphological and molecular characterization of Iotonchus lotilabiatus n. sp. (Nematoda: Iotonchidae) from Lao Cai Province, Vietnam

Tam T. T. Vu, Thi Mai Linh Le, Thi Duyen Nguyen

Journal of Nematology, Volume 53 , 1–22

research-article | 30-November-2020

Description of Prionchulus jonkershoekensis n. sp. (Nematoda: Mononchida), a new predatory species from South Africa

Candice Jansen van Rensburg, Hendrika Fourie, Samad Ashrafi, Milad Rashidifard

Journal of Nematology, Volume 53 , 1–10

research-article | 30-November-2020

Descriptions of two new and one known species of Parkellus Jairajpuri, Tahseen and Choi, 2001 (Nematoda: Mononchidae) and their phylogenetic position among Mononchida

Parkellus rDNA sequence fragments, as well as ribosomal DNA fragments of Coomansus parvus used in this study as a close reference species, were deposited in GenBank under the following accession numbers: MT799665–MT799669 (18S rDNA) and MT799670–MT799673 (28S rDNA). Sequence analysis and phylogenetic studies The newly obtained rDNA sequences were analyzed using the BioEdit program (Hall, 1999: v.7.2.5). The final 18S and 28S rDNA datasets for phylogenetic study included sequences from the three

Tam T.T. VU, Katarzyna Rybarczyk-Mydłowska, Andrij Susulovsky, Magdalena Kubicz, Łukasz Flis, Thi Mai Linh Le, Grażyna Winiszewska

Journal of Nematology, Volume 53 , 1–22

Article | 21-July-2017

Morphological and Molecular Characterization of Two Aphelenchoides Endophytic in Poplar Leaves

LYNN K. CARTA, SHIGUANG LI, ANDREA M. SKANTAR, GEORGE NEWCOMBE

Journal of Nematology, Volume 48 , ISSUE 1, 28–33

Research Article | 03-December-2018

Two nematodes (Nematoda: Diplogastridae, Rhabditidae) from the invasive millipede Chamberlinius hualienensis Wang, 1956 (Diplopoda, Paradoxosomatidae) on Hachijojima Island in Japan

L. K. Carta, W. K. Thomas, V. B. Meyer-Rochow

Journal of Nematology, Volume 50 , ISSUE 4, 479–486

research-article | 13-April-2020

First molecular characterization of an Iranian population of Schistonchus caprifici (Gasparrini, 1864) Cobb, 1927 (Rhabditida; Aphelenchoidea)

in Estahban (Fars province) during the present study, the morphological and morphometric characters of this population were found to be in accordance with the data presented by Hunt (1993), Vovlas and Larizza (1996) and Kolaei et al. (2016). Therefore, the present study aimed to characterize this recently recovered population for its molecular identity by sequencing the D2-D3 expansion fragments of the large subunit of the ribosomal DNA gene, as the first molecular analysis of the Iranian

Hadi Karimipour Fard, Hamid Zare

Journal of Nematology, Volume 52 , 1–3

Original Research | 11-December-2017

Description of Pseudacrobeles (Pseudacrobeles) curvatus sp. n. (Cephalobidae: Rhabditida) in South Korea

and diagnostic features of Pseudacrobeles species and molecular sequence data from the D2-D3 regions of the 28S ribosomal DNA (rDNA) and ITS1-5.8S-ITS2 region of rDNA from the new species, which can be used as molecular barcode sequences.  

Jiyeon Kim, Taeho Kim, Joong-Ki Park

Journal of Nematology, Volume 49 , ISSUE 2, 162–167

Article | 21-July-2017

Sectonema caobangense sp. n. from Vietnam (Nematoda, Dorylaimida, Aporcelaimidae)

SERGIO ALVAREZ-ORTEGA, THI ANH DUONG NGUYEN, JOAQUI´N ABOLAFIA, MICHAEL BONKOWSKI, REYES PEN˜A-SANTIAGO

Journal of Nematology, Volume 48 , ISSUE 2, 95–103

research-article | 30-November-2020

Morphological and molecular characterisation of Tripylina gorganensis from the Slovak Republic as a contribution to the redescription of the species

. yeatesi Zhao, 2009 New Zealand T. ymyensis Tahseen & Nusrat, 2010 China T. zhejiangensis Pham et al., 2013 China Starting with the work by Zhao (2009), half of the described species have been characterized molecularly by partial sequences of either one or two of the ribosomal DNA genes (18 S and/or 28 S rDNA). The rDNA-based phylogenetic analyses revealed the well-supported monophyletic status of Tripylina (Asghari et al., 2012; Cid del Prado-Vera et al., 2012, 2016; Xu et al., 2013

Marek Renčo, Katarzyna Rybarczyk-Mydłowska, Łukasz Flis, Magdalena Kubicz, Grażyna Winiszewska

Journal of Nematology, Volume 53 , 1–10

research-article | 30-November-2019

Morphological and molecular characterization of Heterodera dunensis n. sp. (Nematoda: Heteroderidae) from Gran Canaria, Canary Islands

field differentiation, tail length, and hyaline tail length in J2 (Subbotin et al., 2010). Since the last two decades, employing molecular data such as ITS and 28S of ribosomal DNA and COI gene of mitochondrial DNA to characterize Heterodera species has been a common practice, including DNA barcoding, phylogeny, and even phylogeography (Ferris et al., 1999; Toumi et al., 2013a; Subbotin et al., 2017, 2018). Herein, we characterize Heterodera dunensis n. sp. discovered in a recent exploratory survey

Phougeishangbam Rolish Singh, Gerrit Karssen, Marjolein Couvreur, Wim Bert

Journal of Nematology, Volume 52 , 1–14

Research Article | 03-December-2018

Improved 18S small subunit rDNA primers for problematic nematode amplification

The 18S small subunit (SSU) ribosomal DNA sequence is one of the most useful molecular loci for identification and phylogeny reconstruction of agriculturally important nematodes. Various pairs of universal primers have been developed in the past to amplify short and long nematode sequences. However, certain nematode taxa were not readily amplified and/or sequenced with the existing primer tools. Frequently, the center region of a roughly 1,000 nucleotide segment would be lost. Therefore new

L. K. Carta, S. Li

Journal of Nematology, Volume 50 , ISSUE 4, 533–542

research-article | 30-November-2019

Morphological and molecular characterization of Hoplolaimus pararobustus (Schuurmans Stekhoven and Teunissen, 1938) Sher 1963 with its first report on Zea mays roots in Namibia

corms and roots of banana where they were likely to cause damage to the crop (Sikora et al., 2018). Phylogenetic analysis of Hoplolaimus spp. using D2–D3 expansion of 28 S and internal transcribed spacer (ITS1) ribosomal DNA sequences resolved the phylogeny of the genus and were useful in molecular identification of Hoplolaimus spp. (Bae et al., 2008). In addition, the PCR-RFLP method was applied by different researchers to evaluate the genetic diversity of Hoplolaimus spp. (Robbins et al., 2009

Mariette Marais, Esther van den Berg, Hendrika Fourie, Milad Rashidifard

Journal of Nematology, Volume 52 , 1–12

research-article | 30-November-2018

First report of Longidorus mindanaoensis Coomans, De Ley, Jimenez and De Ley, 2012 (Nematoda: Longidoridae) From a Mangrove Forest in Vietnam

Thi Duyen Nguyen, Huu Tien Nguyen, Thi Mai Linh Le, Neriza Nobleza, Quang Phap Trinh

journal of nematology, Volume 51 , 1–5

research-article | 17-March-2020

Description of Laimaphelenchus sinensis n. sp. (Nematoda: Aphelenchoididae) from declining Chinese pine, Pinus tabuliformis in Beijing, China

Jianfeng Gu, Munawar Maria, Yiwu Fang, Lele Liu, Yong Bian, Xianfeng Chen

Journal of Nematology, Volume 52 , 1–1

research-article | 30-November-2019

An integrative approach to the study of Helicotylenchus (Nematoda: Hoplolaimidae) Colombian and Brazilian populations associated with Musa crops

% Triton x–100, 4.5% Tween–20, 0.09% Proteinase K). The tubes were incubated at −80°C (15 min), 65°C (1 h), and 95°C (15 min), centrifuged to 16,000 g (1 min) and stored at −20°C. Amplification of D2 to D3 expansion segment of the large subunit – LSU of ribosomal DNA (28S) was done using forward primer D2A (5′–ACAAGTACCGTGAGGGAAAGTTG–3′) and reverse D3B (5′–TCCTCGGAAGGAACCAGCTACTA–3′) (De Ley et al., 1999). The PCR conditions were initial denaturation during 2 min at 94°C followed by 40 cycles of 45 s

Donald Riascos-Ortiz, Ana Teresa Mosquera-Espinosa, Francia Varón De Agudelo, Claudio Marcelo Gonçalves de Oliveira, Jaime Eduardo Muñoz-Florez

Journal of Nematology, Volume 52 , 1–19

research-article | 15-August-2017

Description and Distribution of Three Criconematid Nematodes from Hangzhou, Zhejiang Province, China

Maria Munawar, Thomas O. Powers, Zhongling Tian, Timothy Harris, Rebecca Higgins, Jingwu Zheng

Journal of Nematology, Volume 50 , ISSUE 2, 183–206

Research Article | 03-December-2018

First report of Pratylenchus vulnus associated with apple in Tunisia

. Microscopic observation of females and males demonstrated the occurrence of Pratylenchusd vulnus on apple trees. The ribosomal DNA D2-D3 expansion segments of the 28S rRNA and of the Pratylenchus populations were PCR amplified and sequenced. The sequences were compared with those of Pratylenchus species in the GenBank database with high similarity (99%). This comparison reconfirmed the morphological identifications. Phylogenetic studies placed those populations with P. vulnus. This is the first report of

Noura Chihani-Hammas, Lobna Hajji-Hedfi, Hajer Regaieg, Asma Larayedh, Ahmed Badiss, Yu Qing, Horrigue-Raouani Najet

Journal of Nematology, Volume 50 , ISSUE 4, 579–586

research-article | 30-November-2019

Oostenbrinkia pedrami n. sp. (Dorylaimida: Aulolaimoididae) from Iran, with molecular phylogenetic relationships to some other Dorylaimida Pearse, 1942

) buffer (10 mM Tris-Cl, 0.5 mM EDTA, pH 9.0, Qiagen) on a clean slide, and squashed using a clean slide cover with the aid of a pipette tip. The suspension was collected by adding 20 μl of TE buffer after gently removing the slide cover and leaving the solution on the slide (Pedram, 2017). The DNA sample was stored at −20°C until used as the polymerase chain reaction (PCR) template. The near-full-length sequence of the small subunit ribosomal DNA (SSU rDNA) was amplified using the forward primer 18S4

Farahnaz Jahanshahi Afshar

Journal of Nematology, Volume 52 , 1–7

Article | 21-July-2017

Steinernema biddulphi n. sp., a New Entomopathogenic Nematode (Nematoda: Steinernematidae) from South Africa

-pharynx (D% = 46). Hyaline layer occupies approximately half of tail length. Male spicules slightly to moderately curved, with a sharp tip and golden brown in color. The first generation of males lacking a mucron on the tail tip while the second generation males with a short filamentous mucron. Genital papillae with 11 pairs and one unpaired preanal papilla. The new species is further characterized by sequences of the internal transcribed spacer (ITS) and partial 28S regions (D2-D3) of the ribosomal

HARUN CIMEN, VLADIMI´R PU°zA, JIRI NERMUT, JUSTIN HATTING, TSHIMA RAMAKUWELA, SELCUK HAZIR

Journal of Nematology, Volume 48 , ISSUE 3, 148–158

research-article | 18-March-2020

Description of Seinura italiensis n. sp. (Tylenchomorpha: Aphelenchoididae) found in the medium soil imported from Italy

Jianfeng Gu, Munawar Maria, Lele Liu, Majid Pedram

Journal of Nematology, Volume 52 , 1–11

research-article | 22-February-2021

Rotylenchus wimbii n. sp. (Nematoda: Hoplolaimidae) associated with finger millet in Kenya

accepted and its widespread use has also recently been facilitated by a web-based key that draws its basis from cluster analysis (Nguyen et al., 2019). In combination with the morphological features, molecular information such as ITS, 18S, and 28S of ribosomal DNA and COI of mitochondrial DNA have been used for their identification. In the current paper, we characterize a newly discovered Rotylenchus wimbii n. sp. found associated with finger millet, Eleusine coracana (L.) Gaertn. (Planta: Poaceae) in

Phougeishangbam Rolish Singh, Gerrit Karssen, Kelvin Gitau, Cecilia Wanjau, Marjolein Couvreur, Njira Njira Pili, Godelieve Gheysen, Wim Bert

Journal of Nematology, Volume 53 , 1–14

research-article | 06-June-2019

Phylogenetic studies on three Helicotylenchus species based on 28S rDNA and mtCOI sequence data

process as well as to delineate more phylogenetically distant species, which share the same morphology (cryptic species), the support of a molecular approach is needed. To date, only about 20% of Helicotylenchus species has been molecularly characterized using mostly ribosomal DNA fragments (18S, ITS, 28S rDNA; GenBank resources). Mitochondrial cytochrome c oxidase subunit I (mtCOI) sequences were reported for one species, the recently described H. oleae (Palomares-Rius et al., 2018), and a cytochrome

K. Rybarczyk-Mydłowska, E. Dmowska, K. Kowalewska

Journal of Nematology, Volume 51 , 1–17

research-article | 17-March-2020

Molecular approach to confirm traditional identification of Radopholus similis sampled in Tanzania

Doreen M. Mgonja, Gladness E. Temu, Joseph C. Ndunguru, Magreth F. Mziray, Sylvester L. Lyantagaye, Nessie D. Luambano

Journal of Nematology, Volume 52 , 1–8

research-article | 30-March-2020

Characterization of Vittatidera zeaphila (Nematoda: Heteroderidae) from Indiana with molecular phylogenetic analysis of the genus

Andrea M. Skantar, Zafar A. Handoo, Mihail R. Kantor, Lynn K. Carta, Jamal Faghihi, Virginia Ferris

Journal of Nematology, Volume 52 , 1–8

research-article | 30-November-2019

Molecular and morphological characterization of the amaryllis lesion nematode, Pratylenchus hippeastri (Inserra et al., 2007), from California

Zafar A. Handoo, Andrea M. Skantar, Mihail R. Kantor, Saad L. Hafez, Maria N. Hult

Journal of Nematology, Volume 52 , 1–5

research-article | 30-November-2019

Description of Deladenus brevis n. sp. (Sphaerularioidea: Neotylenchidae) from Iran: a morphological and molecular phylogenetic study

Fariba Heydari, Joaquín Abolafia, Majid Pedram

Journal of Nematology, Volume 52 , 1–13

original-paper | 28-March-2019

Predominance of Lactobacillus plantarum Strains in Peruvian Amazonian Fruits

JOHANNA SÁNCHEZ, CARLOS VEGAS, AMPARO IRIS ZAVALETA, BRAULIO ESTEVE-ZARZOSO

Polish Journal of Microbiology, Volume 68 , ISSUE 1, 127–137

research-article | 30-November-2019

Oscheius myriophila (Nematoda: Rhabditida) isolated in sugar cane soils in Mexico with potential to be used as entomopathogenic nematode

Iveth del Rocio Castro-Ortega, Juan Manuel Caspeta-Mandujano, Ramón Suárez-Rodríguez, Guadalupe Peña-Chora, José Augusto Ramírez-Trujillo, Karina Cruz-Pérez, Iván Arenas Sosa, Víctor Manuel Hernández–Velázquez

Journal of Nematology, Volume 52 , 1–8

research-article | 30-November-2020

Laimaphelenchus africanus n. sp. (Tylenchomorpha: Aphelenchoididae) from South Africa, a morphological and molecular phylogenetic study, with an update to the diagnostics of the genus

. The specimens were then transferred to two individual Eppendorf tubes containing 15 µl ddH2O and their respective DNA was extracted using the chelex-100 protocol of Rashidifard et al. (2019). The DNA samples were stored at –20°C until used for amplification. The partial sequences of the large subunit ribosomal DNA (LSU rDNA D2-D3) were amplified using forward primer D2A (5′–ACAAGTACCGTGAGGGAAAGT–3′) and reverse primer D3B (5′–TCGGAAGGAACCAGCTACTA–3′) (Nunn, 1992). The polymerase chain reaction (PCR

Farahnaz Jahanshahi Afshar, Milad Rashidifard, Joaquín Abolafia, Miloslav Zouhar, Hendrika Fourie, Majid Pedram

Journal Of Nematology, Volume 53 , 1–14

research-article | 30-November-2020

Characterization of Globodera ellingtonae Populations from Chile Utilizing Whole Genome Sequencing

C.N. Hesse, I. Moreno, O. Acevedo Pardo, H. Pacheco Fuentes, E. Grenier, L. M. Dandurand, I. A. Zasada

Journal of Nematology, Volume 53 , 1–9

research-article | 30-November-2020

An interesting rare tylenchid species, Antarctenchus urmiensis n. sp. (Tylenchomorpha; Psilenchidae) from Urmia Lake islands, northwest Iran, with a discussion on the taxonomy of related genera

Mohammad Amiri Bonab, Joaquín Abolafia, Majid Pedram

Journal of Nematology, Volume 53 , 1–14

Research Article | 26-September-2018

First Report of Cactodera estonica in Canada

consistent with those of C. estonica, for which the elongated cyst and short hyaline in J2 are characteristic for the species. Ribosomal DNA of the ITS, 18S, and D2/D3 of 28S regions were PCR amplified from cysts and J2s using primers 18S (5′-TTGATTACGTCCCTGCCCTTT-3′) and 26S (5′-TTTCACTCGCCGTTACTAAGG-3′) (Vrain et al., 1992), D2A (5′-ACAAGTACCGTGAGGGAAAGT-3′) (Nunn, 1992) and D3B (5′-GACCCGTCTTGAAACACGGA-3′) (De Ley et al., 1999), and sequenced. The sequences of the ITS and D2/D3 regions of 1,480 and

QING YU, FENGCHENG SUN

Journal of Nematology, Volume 49 , ISSUE 4, 403–403

Article | 24-July-2017

First Report of the Fig Cyst Nematode, Heterodera fici Kirjanova, on Fig Tree, Ficus carica, in Ontario, Canada

National collection of Insects, Arachnids, and Nematodes (Accession no. 14851 to 14853 for the second stage juveniles and 14854–14855 for the cyst cones). For molecular analysis,DNA was extracted from individual juvenile (n = 4) from different cysts. A 1,151-bp fragment of ribosomal DNA containing ITS1-5.8SITS2 region was amplified and sequenced using primers 18S (5'-TTGATTACGTCCCTGCCCTTT-3') and 26S (5'- TTTCACTCGCCGTTACTAAGG-3') (Vrain et al., 1992). The sequence was

FENGCHENG SUN, NEIL HENRY, QING YU

Journal of Nematology, Volume 49 , ISSUE 2, 131–132

No Record Found..
Page Actions